Sybr green

RNA from non-CNS tissues was isolated with the RNeasy Mini kit with on-column DNase digestion (Qiagen). RNA from CNS tissues was isolated with TRIzol (Ambion) and digested with DNase I (InvitroGen). Gene expression was determined by reverse transcriptase quantitative PCR (RT-qPCR), using the SYBR Green (Agilent Technologies) and TaqMan (Applied Biosystems) systems. 50 ng of RNA was used for each reaction. Expression levels were quantified relative to the expression of GAPDH, using the $2^{-\mathrm{\Delta }\mathrm{\Delta }{C}_T}$ method [80 (link)], and normalized to the control group as a fold change. Data are represented as scatter plots with the mean ± SD of biological replicates. The following TaqMan primers were used: mIfnb (Mm00439552_s1; Applied Biosystems), mMx1 (Mm00487796_m1; Applied Biosystems). The following SYBR Green primers were used: mGapdh (FW: 5’-CAA TGT GTC CGT CGT GGA-3’; RW: 5’-GAT GCC TGC TTC ACC ACC-3’), mA20 (FW: 5’-TGC AAT GAA GTG CAG GAG TC-3’; RW: 5’-TGG GCT CTG CTG TAG TCC TT-3’), mIl6 (FW: 5’-GAA AAT CTG CTC TGG TCT TCT GG; RW: 5’-TTT TCTG ACC ACA GTG AGG AAT G), mTnfa (FW 5’-CAC AGC CTT CCT CAC AGA GC; RW: 5’-GGA GGC AAC AAG GTA GAG AGG).

RNA was extracted from cells using Trizol (ThermoFisher) and from virus in supernatant using Trizol LS (ThermoFisher). A one-step qRT-PCR kit with SYBR green from Agilent was used. Reactions were set up according to the manufacturer’s protocol and run on a LightCycler 96 real-time PCR machine (Roche). The cycling parameters were: 20 mins at 50°C for reverse transcription, then 5 mins at 95°C followed by 45 two-step cycles of 95°C for 5 seconds and 60°C for 60 seconds. This was followed by a melt curve starting at 65°C and ending at 97°C. DENV primers [60 (link)] were used to quantify viral RNA copies in the supernatant as well as in cells. A standard curve of in vitro transcribed viral RNA from a DENV2 cDNA subclone was generated and used to quantify the genome copies in the supernatant [61 (link)]. Copies of viral RNA in the cell as well as copies of SCD mRNA transcripts were both normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) RNA using the delta delta ct method [62 (link)]. For this method: the fold change in gene expression = 2^(-(Infected samples((Ct value of gene of interest)–(Ct value of control gene)))–(Uninfected samples ((Ct value of gene of interest)–(Ct value of control gene)))). The Ct values were generated from the Light Cycler software and the gene of interest was either SCD1 or DENV and the control gene was GAPDH.

Total RNA was extracted and purified using the RNeasy Mini Kit (QIAGEN, Valencia, CA, USA) according to the manufacturer’s protocol. Relative quantification of gene expression was performed using real-time RT-PCR on the Mx3005P Real-Time PCR System (Strategene, Agilent technologies Santa Clara, CA, USA) with SYBR Green (Agilent technologies, 600548, Santa Clara, CA, USA) according to the manufacturer’s protocol. The following primers were used in real-time PCR amplification: Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) forward: 5 -CTACACTGAGGACCAGGTTGTCT −3, reverse: 5- GGTCTGGGATGGAAATTGTG −3; Protein kinase A (PKA) forward: 5- CAGGAAAGCGCTCCAGATAC −3, reverse: 5- AAGGGAAGGTTGGCGTTACT −3; Epac1 forward: 5- GTTGTCGACCCACAGGAAGT −3, reverse: 5- ACCCAGTACTGCAGCTCGTT −3; Epac2 forward: 5- GCATTGAGCAGGAGGACTTC −3, reverse: 5- AACGTGGGGTTCAATGAGAG −3; A_2AR forward: 5- AGCCAGGGGTTACATCTGTG −3, reverse: 5- TACAGACAGCCTCGACATGTG −3. mRNA abundance was determined relative to that of GAPDH.

Total RNA was extracted from liver tissue using a commercially available RNA extraction kit according to the manufacturer’s protocol (Agilent Technologies, Santa Clara, CA). After spectroscopic quantification, RNA was reverse-transcribed, and cDNA was analyzed by real-time quantitative PCR using SYBR green (600882, Agilent Technologies) master mix. Primers specific for individual genes were purchased from Invitrogen or IDT. Data were normalized to housekeeping genes Gapdh or Actb. Relative amounts of the target gene were calculated using the ΔΔCt formula.

Cell line and tumor RNA was extracted using the RNeasy Mini kit (QIAGEN) according to the supplier’s instructions. The extracted RNA was assayed using NanoDrop at 260 nm (Thermo Fisher Scientific). RT was performed by adding 1 μg of RNA to 10 μl of a mixture (RT buffer DNX 25×, 100 mM; RT random primers 10×; MultiScribe Reverse Transcriptase; and H₂O [Applied Biosystems]). RT was performed in a thermocycler at 25°C for 10 min, 37°C for 2 h, 85°C for 5 min, and then 4°C. cDNA (50 ng/μl) was mixed with 24 μl of a mixture of SYBR Green (Agilent, Stratagene), right and left primers, and H₂O. PCR was then performed using the Stratagene Mx 3000 Pro QPCR (Agilent Technologies) according to the following profile: one cycle of 10 min at 95°C, and then 40 cycles of 30 s at 95°C and 1 min at 60°C. The results were analyzed using MxPro software (Stratagene). Human GAPDH (NM_002046.3; AB Applied Biosystems) was used as an internal control. The qRT-PCR were routinely performed with two technical replicates and three biological replicates. The qRT-PCR data were presented as delta Ct values of the investigated genes relative to GADPH.