Power sybr green pcr master mix

Total RNA was isolated from tissues using the Isogen reagent (Wako) and reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen). PCR was performed using the Power SYBR Green PCR Master Mix (Roche) and LightCycler® (Roche). All expression levels were normalized to that of S18 mRNA.
Real-time RT-PCR primers used (5′ to 3′):

	Forward	Reverse
cd36	ttgtacctatactgtggctaaatgaga	cttgtgttttgaacatttctgctt
cidea	aaaccatgaccgaagtagcc	aggccagttgtgatgactaagac
cpt1a	gctgtcaaagataccgtgagc	tctccctccttcatcagtgg
elovl3	gaggcctctcatcctctggt	ttgccataaacttccacatcc
cpt1b	gcccatgtgctcctacca	ctctgagaggtgctgtagcaag
dio2	ctgcgctgtgtctggaac	ggagcatcttcacccagttt
fgf21	cacaccgcagtccagaaag	tgacacccaggatttgaatg
lipe (HSL)	agcgctggaggagtgtttt	ccgctctccagttgaacc
pnpla2 (ATGL)	tgaccatctgccttccaga	tgtaggtggcgcaagaca
slc27a1 (FATP1)	gacaagctggatcaggcaag	gaggccacagaggctgttc
slc27a3 (FATP3)	gagaacttgccaccgtatgc	ggtctcagtagtggccaaaga
slc27a4 (FATP4)	ggcagtgagatggcctca	cagagcagaagaggctgagtg
S18	tccagcacattttgcgagta	cagtgatggcgaaggctatt
ucp1	gatgtggtaaaaacaagattcatca	cgcagaaaagaagccacaa

Total RNA was extracted with TRIzol reagents (Invitrogen). For mRNA analysis, 1 μg of total RNA was reverse transcribed by using a Revert Aid first strand cDNA synthesis kit (Roche). The cDNA was analyzed using Power SYBR green PCR master mix (Roche) with a Roche 480 system. The mRNA quantitative PCR data were normalized to Gapdh. Primer sequences are listed in Supplementary Table 1.

Total RNA isolation and purification was carried out as detailed elsewhere (6 (link)). Real-time quantitative RT-PCR (RT-qPCR) assays were performed as previously detailed with several modifications (6 (link)). In this case, real-time PCR was performed using an 7900 HT Fast Real-Time PCR System instrument (Applied Biosystems) in a final volume of 10.7 μl containing 4.5 μl of a 100-fold dilution of the RT reaction, 5 μl of the Power SYBR Green PCR Master Mix (Roche) and 0.6 μl of each 5 μM primer stock (Sigma). Basic analysis was performed using the SDS 2.3 and RQ-Manager 1.2 softwares (Applied Biosystems). For quantification, the abundance of each gene was determined relative to the standard transcript of ACT1 for input cDNA normalization, and the final data on relative gene expression between the conditions tested were calculated following the 2^−ΔΔCt method (48 (link)). Primer sequences are listed in Supplementary Table S1.

Total RNA was extracted using the RNeasy Mini kit (Qiagen, Germany) and converted into cDNA with the Reverse Transcription System (Promega, USA) according to the manufacturer’s protocol. Quantitative polymerase chain reaction (PCR) was performed on a LightCycler 480 Real-Time PCR System using Power SYBR Green PCR Master Mix (Roche, Switzerland). Relative mRNA levels were normalized to those of β-actin mRNA. The primers used in these experiments have been described in previous reports (Chen et al., 2009 (link); Cochrane et al., 2007 (link); Kase et al., 2010 (link)).

Mouse studies strictly adhered to the recommendations of the Institutional Animal Care and Use Committee, and all protocols were approved by the Committee at the National University of Singapore. Thymus specimens from 8- to 10-wk-old NOD-Rag1^nullIL2rg^null (NRG) mice were harvested and sorted by fluorescence-activated cell sorting (FACS) into DN1 (CD44⁺CD25⁻), DN2 (CD44⁺CD25⁺), and DN3 (CD44⁻CD25⁺) populations. Total RNA was harvested using an RNeasy Plus minikit (Qiagen) and reverse-transcribed into cDNA using SuperScript IV reverse transcriptase (Thermo Fisher Scientific). qPCR was performed on a QuantStudio 3 real-time PCR system (Thermo Fisher Scientific) using Power SYBR Green PCR Master mix (Roche) and specific primers for individual genes.