To identify the determinant involved in florfenicol resistance, we conducted random mutagenesis of transformant NT161 with the EZ-Tn5 Insertion kit (Epicentre Biotechnologies) (18 (link)). The transposon mutants were screened on MH agar plates containing kanamycin (50 mg/liter). Clones selected on the kanamycin plates were inoculated simultaneously onto two types of MH agar plates containing kanamycin (50 mg/liter) and florfenicol (4 mg/liter), respectively. Clones that failed to grow on plates containing 4 mg/liter florfenicol but grew on plates containing kanamycin at 50 mg/liter were selected to confirm the kanamycin resistance gene aphA-3 insertion by PCR and its flanking regions by a modified random primer walking sequencing method (37 (link)).
Ez tn5 insertion kit
Manufactured by Illumina
Sourced in United States
The EZ-Tn5 Insertion Kit is a laboratory tool designed for the insertion of Tn5 transposons into target DNA samples. The kit provides the necessary reagents and enzymes to facilitate this process, enabling efficient DNA fragmentation and incorporation of the transposon sequences.
Automatically generated - may contain errors
Lab products found in correlation
Bigdye terminator kit, by Thermo Fisher Scientific (2 mentions)
Fosmidmax dna purification kit, by Illumina (1 mentions)
Abi 3500xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Accuprep genomic dna extraction kit, by Bioneer (1 mentions)
Accuprep plasmid mini extraction kit, by Bioneer (1 mentions)
Sanger sequencing, by Bioneer (1 mentions)
Sanger sequencing, by Beckman Coulter (1 mentions)
Nanodrop n 1000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Nucleobond pc 20 kit, by Macherey-Nagel (1 mentions)
Nutrient agar plate, by Thermo Fisher Scientific (1 mentions)
12 protocols using ez tn5 insertion kit
1
Identifying Florfenicol Resistance Determinants
2
Gene Disruption by EZ-Tn5 Transposon
3
Transposon Mutagenesis of Antinematode Fosmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A transposon mutant library of the antinematode fosmid clone 20G8 was generated using an in vitro transposon mutagenesis kit (EZ-Tn5 insertion kit; Epicentre) following the manufacturers' instructions. The DNA fosmid sequence for clone 20G8 is available from the National Center for Biotechnology Information (NCBI) public database (GenBank) via accession number JX523957. The subsequent library of 96 E. coli transposon mutants was replicated on LB10 Omnitray plates (Nunc, Denmark), and screened for loss of toxic activity towards C. elegans as previously described [31] (link). Clones that were partially or totally grazed by the nematodes were chosen for further characterization in the nematode killing assay (below). The disrupted genes were identified by outward sequencing from the transposon using the KAN-2 forward and reverse primers (Epicentre) (KAN-2 Forward Primer 5' ACCTACAACAAAGCTCTCATCAACC 3', KAN-2 Reverse Primer 5' GCAATGTAACATCAGAGATTTTGAG 3') and sequences were subjected to BLAST analysis [32] (link).
4
Generation of Xf Mutant XfΔ1063 for Study
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PD1063 was PCR amplified from the Xf wild type Fetzer genome using primer pairs PD1063for (5′-TCAGCGCTCTAAAACAATGGCGA-3′ ) and PD1063rev (5′-CACAGCCCGCCTATGGCACA ) and the 1015 bp product was cloned into pCR2.1-TOPO vector to generate pCR2.1-PD1063 (Table 1 ). The plasmid was digested with SacI and XbaI and the resulting fragment was cloned into SacI/XbaI digested pUC18 vector to generate pUC18-PD1063. A kanamycin resistance gene was randomly inserted into pUC18-PD1063 using the EZ-Tn5 Insertion Kit according to the manufacturer's instructions (Epicentre, California), generating pUC18-PD1063:kan. Sequencing using primers kan-2RP-1/kan-2FP-1 determined the location of the kanamycin cassette insertion was at 102 bp. Plasmid pUC18-PD1063:kan was electroporated into electrocompetent Xf wild-type Fetzer cells as previously described [22] (link)–[24] (link), creating the Xf mutant XfΔ1063. Double crossover mutants were confirmed by PCR analysis of the clones using primer pair PD1063chkfor (5′- CAGTTGCAAAACTCCAAGCACAACA-3′ ) and PD1063chkrev (5′- GCGGCGGATCATGAACCTA-3′ ) and results are shown in Figure 1 .
5
Fosmid-based Transposon Mutagenesis for Lipase Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fosmid DNA was isolated from clones using the FosmidMAX DNA purification kit (Epicentre, USA) and the isolated fosmids were used for in vitro transposon mutagenesis using the commercially available EZ-Tn5 insertion kit (Epicentre, USA). Mutants exhibiting no zone formation on tributyrin-agar plates were sequenced using the primers supplied with the kit to identify the inactivated gene. Nucleotide sequencing was performed with an ABI 3100 automated sequencer using a BigDye Terminator kit (Perkin-Elmer Applied Biosystems, Foster City, CA). DNA sequence analysis, database search, and gene characterization were carried out at the National Center for Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov/ ) using web-based programs and resources.
6
Identification of Chitinolytic Genes from FosChit
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The FosChit DNA was isolated and mechanically fragmented. The fragments were
separated by agarose gel electrophoresis and the fragments of 3 and 5 Kb were
purified and cloned in pUC18 or pCR2.1 plasmid. This sublibrary of the FosChit was
screened for chitinolytic activity on modified LA-chitin plates. Both ends of the
inserts of active subclones were sequenced on an ABI 3500xL Genetic Analyzer (Applied
Biosystems, USA) automated sequencer using Big Dye Terminator Kit and pUC M13 primers
(Applied Biosystems). The plasmids of active clones were also submitted to a random
insertion of EZ-Tn5 obtained by in vitro transposon
insertion reaction with the EZTn5 Insertion Kit (Epicentre). Both ends
of the insertion regions of 96 subclones were also sequenced using the transposon
forward and reverse primers provided with the insertion kit. Sequence assembly and
editing were performed with the Phred-Phrap-Consed software (16 (link)). The amino acid sequences were compared with the
non-redundant sequence database deposited at NCBI using BLAST.
separated by agarose gel electrophoresis and the fragments of 3 and 5 Kb were
purified and cloned in pUC18 or pCR2.1 plasmid. This sublibrary of the FosChit was
screened for chitinolytic activity on modified LA-chitin plates. Both ends of the
inserts of active subclones were sequenced on an ABI 3500xL Genetic Analyzer (Applied
Biosystems, USA) automated sequencer using Big Dye Terminator Kit and pUC M13 primers
(Applied Biosystems). The plasmids of active clones were also submitted to a random
insertion of EZ-Tn5
insertion reaction with the EZTn5
of the insertion regions of 96 subclones were also sequenced using the transposon
forward and reverse primers provided with the insertion kit. Sequence assembly and
editing were performed with the Phred-Phrap-Consed software (16 (link)). The amino acid sequences were compared with the
non-redundant sequence database deposited at NCBI using BLAST.
7
EZ-Tn5 Mutagenesis and Marker Exchange
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pICL1 and pPEP1 were mutagenized using a EZ-Tn5 insertion kit (Epicentre, Madison, WI) and marker exchange, as described previously (10 (link)). All constructs were confirmed by Southern blot analysis. The EZ-Tn5 insertion sites were determined by DNA sequencing according to the manufacturer’s protocols.
8
Screening Transposon Mutants in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A transposon random mutant library of E. coli ATCC 43888 was constructed using the EZ-Tn5™ insertion Kit, according to the manufacturer’s instructions (Epicenter, Madison, WI, USA). A total of 1500 kanamycin-resistant mutant colonies were obtained, and each colony was cultured in 1 mL of LB broth containing 50 μg/mL kanamycin. To screen the BECP10 resistant mutants, each overnight cultured mutant was inoculated in 96-well plates containing LB broth, and BECP10 was added (MOI = 100). Plates were incubated at 37 °C for 5 h, and phage-insensitive mutants were screened by measuring the OD600 values. Screened mutants were cultured on 96-well plates in the same manner as above, and phage ECP26 (rV5-like phage) was added (MOI = 100) and lysed mutants were reselected. Genomic DNA was extracted from the reselected mutants using the AccuPrep® Genomic DNA Extraction Kit (Bioneer, Korea) for rescue cloning. Rescue cloning was performed according to the EZ-Tn5™ insertion kit protocol. The Tn5 cassettes were transformed into E. coli DH5α by electroporation, and amplified Tn5 cassettes were extracted using the AccuPrep® Plasmid Mini Extraction Kit (Bioneer, Korea). The transposon insertion sites were identified by Sanger sequencing (Bioneer, Korea) and BLAST analysis.
9
Identifying Triclosan Resistance Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Secondary library was constructed in pUC119 following the previously described procedure38 (link) and TCS resistant subclones (primary subclones) were selected. Once the nucleotide sequence analysis of the TCS-resistant clone was completed, the candidate gene(s) for TCS resistance were further subcloned into pUC119 or the pGEM®-T Easy vector (secondary subclones) and tested at a similar concentration of TCS as the parental clones. Metagenomic TCS-resistant clones that failed to produce subclones with restriction digestion were processed using Tn-5 transposon mutagenesis using the EZ-Tn5™ Insertion Kit (Epicentre) to select for the genes responsible for TCS resistance. Transposon mutagenesis was performed according to the manufacturer’s protocol. Mutants that were unable to grow on TCS-containing medium were selected, and transposon insertion sites were sequenced.
10
Fosmid DNA Isolation and Transposon Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Macherey-Nagel Nucleobond PC20 kit (MN, Hoerdt, France) was used to isolate fosmidic DNA using the manufacturer’s protocol. DNA was quantified using a NanoDrop N-1000 spectrophotometer (NanoDrop Technologies) and quality assessment was performed with 0.6% (w/v) ethidium bromide-stained agarose electrophoresis.
Transposon mutagenesis was carried out on fosmidic DNA using the EZ-Tn5 Insertion Kit and Transformax electro-competent E. coli EC100-T1r cells (Epicentre Technologies, Madison, USA) following the manufacturer’s protocol. Inactivated clones for polysaccharidic activity were then identified by plating the kanamycin-resistant transposon insertion clones on LB-Cm-Kan agar plates supplemented with the appropriate polysaccharide. Sanger sequencing (Beckman Coulter Genomics, United Kingdom) was performed to localize the transposon insertion site in metagenomic insert DNA of inactivated clones, using the FP-1 and/or RP-1 primers supplied in the kit.
Transposon mutagenesis was carried out on fosmidic DNA using the EZ-Tn5
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!