The HMF hydrogenation reactions were carried out in a 100 mL stainless steel autoclave equipped with a mechanical stirrer and a thermocouple. In a typical experiment, 0.1550 g of HMF (Sigma-Aldrich, 99%) were dissolved in 15 mL of 2-butanol (Sigma-Aldrich, 99%). The solution was placed into a glass inlet with the appropriate amount of activated catalyst (Ru:HMF molar ratio of 1:100). The system was then sealed and purged with N2 first and then H2, which pressurized the reactor to the desired pressure (20 bar). The autoclave was heated up to 150 °C and the solution was stirred at 1000 rpm. Samplings were carried out by stopping the stirring and quenching of the reaction of the samples in an ice bath. A sample of the reaction solution (ca. 500 µL) was withdrawn and centrifuged in order to separate the catalyst from the solution. The filtrate was diluted with a solution of an external standard (dodecanol, Sigma-Aldrich, >98%) for GC measurement. Product analysis was carried out with a GC-MS (Thermo Scientific, Waltham, MA, USA, ISQ QD equipped with an Agilent VF-5ms column) and the resulting fragmentation peaks were compared with standards present in the software database. Product quantification was carried out through a GC-FID equipped with a non-polar column (Thermo Scientific, TRACE 1300 equipped with an Agilent HP-5 column).
Dodecanol
Manufactured by Merck Group
Sourced in United States
Dodecanol is a long-chain primary alcohol with the formula CH3(CH2)10CH2OH. It is a colorless, waxy solid at room temperature. Dodecanol is commonly used as an intermediate in the production of various chemicals, surfactants, and lubricants.
Automatically generated - may contain errors
Lab products found in correlation
Octanal, by Merck Group (2 mentions)
Decanal, by Merck Group (2 mentions)
Dodecanoic acid, by Merck Group (2 mentions)
Oleic acid, by Merck Group (2 mentions)
Hydroxybenzotriazole, by Merck Group (2 mentions)
Matrigel basement membrane matrix, by Corning (2 mentions)
1 ethyl 3 3 dimethylaminopropyl carbodiimide, by Merck Group (2 mentions)
Ethylene dimethacrylate, by Merck Group (2 mentions)
Hp 5 column, by Agilent Technologies (1 mentions)
2 butanol, by Merck Group (1 mentions)
Isq qd, by Agilent Technologies (1 mentions)
Vf 5ms column, by Agilent Technologies (1 mentions)
Trace 1300, by Agilent Technologies (1 mentions)
Dodecene, by Merck Group (1 mentions)
Geranyl acetone, by Merck Group (1 mentions)
Palmitoleic acid, by Merck Group (1 mentions)
Tetradecanol, by Merck Group (1 mentions)
Nonanoic acid, by Merck Group (1 mentions)
Hexadecanol, by Merck Group (1 mentions)
Octadecanol, by Merck Group (1 mentions)
10 protocols using dodecanol
1
Hydrogenation of 5-Hydroxymethylfurfural
2
Dodecane and Chemical Standards Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Laboratory grade dodecane (D–H, D = C12H25) was purchased from Fisher Chemical and used as is. Analytical standard grade chemicals used for GC-TOFMS identification of octanol, octanal, decanal, dodecanol, and dodecene were purchased from Sigma Aldrich and used as is. All other compounds were synthesized in-house and had a purity >97% as measured with 13C- and 1H-NMR spectroscopy.
3
Fatty Acids and Hydrocarbons Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The linear (C7-C30) hydrocarbons, squalene, nonanal, (E)-2-nonenal, (E)-2-decenal, decanal, (E,Z)-2,4-decadienal, nonanol, dodecanol, tetradecanol, hexadecanol, octadecanol, docosanol, nonanoic acid, dodecanoic acid, myristic acid, palmitoleic acid, palmitic acid, linoleic acid, oleic acid, and geranyl acetone were purchased from Sigma-Aldrich, and 2,13-octadecadienol diastereomers were kindly donated by Dr. Wittko Francke from the University of Hamburg.
4
Comprehensive Analysis of Volatile Compounds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The standards of volatile compounds were purchased from Sigma-Aldrich (St. Louis, MO, USA), including isobutanol, 3-methyl-1-butanol, cis-3-hexen-1-ol, 1-hexanol, heptanol, octanol, phenethyl alcohol, 2,6-nonadien-1-ol, dodecanol, ethyl acetate, isoamyl acetate, ethyl lactate, ethyl hexanoate, ethyl octanoate, diethyl succinate, phenethyl acetate, ethyl decanoate, butanoic acid, hexanoic acid, octanoic acid, dodecanoic acid, octanal, (2e,6z)-2,6-nonadienal, benzaldehyde, furfural, citronellol, linalool, rose oxide, geraniol, nerol, β-damascenone, β-ionone, nerolidol, hexanal, guaiacol, 4-Ethylphenol, and 2-octanol which were used as the internal standard.
Folin–Ciocalteu reagent and sodium chloride were purchased from Beijing Chemical Works (Beijing, China). Potassium hydrogen tartrate were purchased at Kemiou Chemical Reagent Co. (Tianjin, China). Bovine serum albumin was obtained from Asahi Kasei Corporation (Tokyo, Japan). Deionized water (<18 MW resistance) was purified by using a Milli-Q purification system (Molecular, Chongqing, China). Bentonite, soybean protein and potassium metabisulfite were purchased from Lallemand Company (Lallemand, Toulouse, France).
Folin–Ciocalteu reagent and sodium chloride were purchased from Beijing Chemical Works (Beijing, China). Potassium hydrogen tartrate were purchased at Kemiou Chemical Reagent Co. (Tianjin, China). Bovine serum albumin was obtained from Asahi Kasei Corporation (Tokyo, Japan). Deionized water (<18 MW resistance) was purified by using a Milli-Q purification system (Molecular, Chongqing, China). Bentonite, soybean protein and potassium metabisulfite were purchased from Lallemand Company (Lallemand, Toulouse, France).
5
Cardiomyocyte Differentiation Assay
6
Antioxidant and Anti-Inflammatory Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ROS, CAT, SOD (WST-8 method), the CCK-8 detection kit, and antioxidant NAC were purchased from Biyuntian Company (Shanghai, China). The POD detection kit, MC903, bovine serum albumin (BSA), cobalt acetylacetonate, dodecanol, octadecene, oleic acid, and oleylamine were purchased from Sigma (Shanghai, China). H2O2, ethanol, and isopropanol were purchased from Shenggong Company (Shenzhen, China). Rabbit anti-IgG and TSLP antibody (ab188766) were purchased from Abcam (Cambridge, UK). EDTA antigen retrieval solution, an immunohistochemistry kit, TB staining solution, and glacial acetic acid were purchased from Servicebio (Wuhan, China). Xylene and neutral gum were purchased from Sinopharm (Beijing, China). Dexamethasone (compound dexamethasone acetate gel) was purchased from Jinri Pharmaceutical Company (Xiamen, China).
7
Synthesis of Peptide-Based Compounds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The resin Rink amide and the reagents Fmoc-Ser(tBu)-OH, Fmoc-Pro-OH, Fmoc-Ile-OH, Fmoc-Asn(Trt)-OH, Fmoc-Thr(tBu)-OH, Fmoc-Lys(Boc)-OH, Fmoc-His(Trt)-OH, Fmoc-Glu(OtBu)-OH, Fmoc-Ala-OH, Fmoc-Arg(Pbf)-OH, Fmoc-Cys(Trt)-OH, Fmoc-6-aminohexanoic acid (Fmoc-Ahx-OH), dicyclohexylcarbodiimide, and 1-hydroxy-6-chlorobenzotriazole were purchased from AAPPTec (Louisville, KY, USA). The reagents acetonitrile, trifluoroacetic acid, dichloromethane, diisopropylethylamine, N,N-dimethylformamide, ethanedithiol, isopropanol, methanol, and triisopropylsilane were purchased from Merck (Darmstadt, Germany). SPE columns Supelclean™, 6-maleimidohexanoic acid (6-MhxA), tetrabutylammonium chloride, glycidyl methacrylate (GMA), ethylene dimethacrylate (EDMA), cyclohexanol, dodecanol, 1,1′-azobis(cyclohexanecarbonitrile), silica gel, Tween 20, and 3,3′,5,5′-tetramethylbenzidine (Liquid Substrate System for ELISA) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Potassium diacid phosphate, sodium acid phosphate, sodium chloride, and potassium chloride were purchased from AppliChem Panreac (Barcelona, Spain).
8
Synthesis of Dodecyl Derivatives
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nitric acid (fuming), triflouroacetic anhydride were purchased from Acros chemical and used as received. Dodecanol, dodecylamine and 1-bromododecane were all purchased from Sigma Aldrich (reagent grade) and used as received. Deuterated solvents (chloroform d) were purchased from Cambridge Isotope Laboratories and used as received. 1H-NMR and 13C-NMR spectra were recorded on a 400 MHz Bruker spectrometer. NMR signals were referenced to residual solvent signals in the deuterated solvents. Synthesis reaction schemes can be found in Fig. S2 in the ESI.†
9
Synthesis of Cy5.5-labeled let-7b miRNA Conjugate
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dodecanol (DC), trimethylamine (TEA), 1-ethyl-3-(3- (dimethylamino)propyl) carbodiimide (EDC), hydroxybenzotriazole (HOBT), 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU), benzyl bromide, 2, 2-bis (hydroxymethyl) propionic acid, methoxy poly (ethylene glycol) (mPEG, Mn = 5000, PDI= 1.03), stannous 2-ethyl hexanoate (Sn(Oct)2) and olomoucine were purchased from Sigma-Aldrich (St. Louis, MO). Tetraethylenepentamine (TEPA) was purchased from Alfa-Aesar (Ward Hill, MA). Cy5.5-let-7b (mature sequence UGAGGUAGUAGGUUGUGUGGUU) was purchased from Invitrogen (Carlsbad, CA). GDC-0449 was purchased from LC Laboratories (Boston, MA). Matrigel matrix basement membrane was procured from Corning (Chicago, IL). All other reagents were purchased from Sigma-Aldrich and used without further purification.
10
Synthesis and Characterization of S-Nitrosoglutathione
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!