Ach3k9

ChIP assay was performed by using a commercially available ChIP kit according to the manufacturer’s protocol (Millipore, Billerica, MA). Briefly, the fresh spinal cord samples were cross-linked in phosphate buffered saline containing 1% formaldehyde (Sigma) and then quenched with glycine to a final concentration of 125 mM as previously described ^{23 (link)}. Lysates were sonicated on ice for 8 min (10 seconds on and 10 seconds off) using Vibra Cell sonicator with a 2-mm microtip, followed by immunoprecipitation with specific antibody (5μg) against acetylated histone H3 at lysine 9 (AcH3K9) (Millipore) or IgG (Millipore) as negative control. Input control consisted of 1% sonicated chromatin. Target gene promoter enrichment in ChIP samples was measured in duplicate by quantitative PCR. Primer sequences used to amplify the promoter region were designed by the Primer 3 program: CXCL1, ATCTAGGAACCCCCTCCTCA (forward), and AGCATCCCTACCCTGCTGTA (reverse). Data were analyzed using the 2- Ct method and normalized with input samples as described previously ^{39 (link)}. Melting curves were performed to document single product formation and agarose electrophoresis confirmed product size.

After balancing of the samples based on protein amount, Western blotting was performed to investigate the expression of caspase-3, cleaved caspase-3, Bcl-2, phospho-GSK-3β, β-catenin, and histone 3 acetylated at lysine 9 (ACH3K9). Equal quantities of protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on 12% polyacrylamide gels and subsequently transferred to nitrocellulose membranes (Bio-Rad Laboratories, Hercules, CA). Membranes were blocked in 0.05% tris-phosphate buffered saline-Tween 20 (TBS-T) containing 5% milk and then incubated in primary antibody diluted in TBS-T containing 5% bovine serum albumin (Sigma-Aldrich, St. Louis, MO) overnight at 4°C. Primary antibodies for caspase-3, cleaved caspase-3, Bcl-2, and phospho-GSK-3β were purchased from Cell Signaling Technologies (Danvers, MA), β-catenin from Invitrogen (Camarillo, CA), ACH3K9 from Millipore (Temecula, CA), and β-actin from Sigma-Aldrich. Each primary antibody was detected using IRDye 680RD conjugated secondary antibodies (LI-COR Bioscience, Lincoln, NE) at 1:5000 in TBS-T with 5% milk at room temperature for one hour. The signals were visualized using Odyssey CLx Infrared Imaging System (LI-COR) and protein density was quantified using ImageJ software (National Institutes of Health, Bethesda, MD).