Mscv pig

Manufactured by Addgene

Sourced in United States

The MSCV-PIG is a retroviral vector that allows for the expression of a gene of interest and the puromycin resistance gene in mammalian cells. It contains the murine stem cell virus (MSCV) long terminal repeat (LTR) promoter, an internal ribosome entry site (IRES), and the puromycin resistance gene.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Pljm1 egfp lentiviral vector, by Addgene (1 mentions) Puro ires gfp, by Addgene (1 mentions) Ecori, by Thermo Fisher Scientific (1 mentions) Xhoi, by Thermo Fisher Scientific (1 mentions) Puc57 sgrna expression vector, by Addgene (1 mentions) Pcmv delta r8, by Addgene (1 mentions) Polybrene, by Santa Cruz Biotechnology (1 mentions) Hepes buffer, by Thermo Fisher Scientific (1 mentions) Pcmv vsv g, by Addgene (1 mentions) Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions) Caski, by National Collection of Authenticated Cell Cultures (1 mentions) Pcdna3 tet2, by Addgene (1 mentions)

7 protocols using mscv pig

BDH1 Gene Cloning and Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CDS of BDH1, encoding the human BDH1 gene, was amplified through PCR using primers 5′-TATAGCTAGCATGCTGGCCACCCG-3′ and 5′-TATAACCGGTTCAGCGGATGTAGATCAT-3′, and then cloned into pLJM1-EGFP lentiviral vector (Addgene, 19319). The CDS of mouse Bdh1 gene was amplified through PCR using primers 5′-TATACTCGAGATGCTAGCTGCC-3′ and 5′- TATAGAATTCTCAGTGTATGTAGATCTTGT-3’, and then ligated into a retroviral vector, namely MSCV-PIG (Addgene, 105594).

Han F., Zhao H., Lu J., Yun W., Yang L., Lou Y., Su D., Chen X., Zhang S., Jin H., Li X., Sun J., Huang H., Wang Q, & Jiang X. (2021). Anti-Tumor Effects of BDH1 in Acute Myeloid Leukemia. Frontiers in Oncology, 11, 694594.

+ Open protocol

+ Expand

Cloning of Tumor Suppressor Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

TSG cDNAs (see Supplementary Table S10) were cloned, by PCR (using primers listed in Supplementary Table S9) followed by restriction enzyme digestion, into MSCV PIG (Puro-IRES-GFP) (Addgene plasmid 18751). For some genes, a 3xFlag tag sequence was incorporated into the primers for cloning in-frame with the target gene. For further details, please refer to the Supplementary Methods.

Lin L., Chamberlain L., Pak M.L., Nagarajan A., Gupta R., Zhu L.J., Wright C.M., Fong K.M., Wajapeyee N, & Green M.R. (2014). A Large-Scale RNAi-Based Mouse Tumorigenesis Screen Identifies New Lung Cancer Tumor Suppressors that Repress FGFR Signaling. Cancer discovery, 4(10), 1168-1181.

+ Open protocol

+ Expand

Retroviral Expression of XBP1 and UFBP1

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA from mouse XBP1u, XBP1s, and human Ufbp1, and its mutant Ufbp1K267R were cloned into retrovirus vector MSCV-PIG (Addgene, cat# #18751) and/or MSCV-Thy1.1 (Addgene, cat# 17442). Retroviruses were prepared using Plat-E packaging cell line (Cell Biolabs, Inc, cat # RV-101). Viral supernatants were concentrated by centrifugation at 10,000 × g at 4 °C overnight. LPS-stimulated B cells were infected with retrovirus by centrifugation at 700 × g for 30 min in the presence of 4 µg/ml polybrene. Two days after infection, cells were analyzed as indicated in figure legends.

Zhu H., Bhatt B., Sivaprakasam S., Cai Y., Liu S., Kodeboyina S.K., Patel N., Savage N.M., Sharma A., Kaufman R.J., Li H, & Singh N. (2019). Ufbp1 promotes plasma cell development and ER expansion by modulating distinct branches of UPR. Nature Communications, 10, 1084.

+ Open protocol

+ Expand

Constructing LentiCRISPR-v2 and MSCV-P11 Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols

LentiCRISPR-v2 plasmid was a gift from Dr. Feng Zhang of Broad Institute of MIT and Harvard. LentiCRISPRv2-p11-gRNA was constructed as described previously 45 (link), 46 (link). Briefly, P11-gRNAs were designed according to CRISPR Design Tool (http://crispr.mit.edu/) and synthesized with BsmBI sticky end, then annealed and inserted into the BsmBI (Fermentas, Vilnius, Lithuania) digested lentiCRISPR-v2 plasmid. For constructing lentiviral vector MSCV- P11, the P11 coding sequence was amplified using wild-type MEF cDNA as the template, and then digested with XhoI and EcoRI (Fermentas), and cloned into MSCV PIG(18751, Addgene, Cambridge, USA). Primer sequences are described below (restriction enzyme recognition sites shown underlined):
F(5'-3'): AATCTCGAGATGCCATCCCAAATGGAGCAC; R(5'-3'): AATGAATTCCTACTTCTTCCCCTTCTGCT.
Cas9 expression vector (pST1374-N-NLS-flag-linkerCas9) for in vitro transcription (44758) and PUC57-sgRNA expression vector (51132) were obtained from Addgene. P11-gRNAs were designed according to CRISPR Design Tool (http://crispr.mit.edu/). Synthesized oligos for gRNA expression were denatured at 95 °C for 5 minutes and annealed at room temperature, then cloned into linearized PUC57-sgRNA expression vector.

Liu G., Wang Y., Zheng W., Cheng H, & Zhou R. (2019). P11 Loss-of-Function is Associated with Decreased Cell Proliferation and Neurobehavioral Disorders in Mice. International Journal of Biological Sciences, 15(7), 1383-1395.

+ Open protocol

+ Expand

Retroviral Overexpression of MYC Mutant

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse Myc^T58A cDNA was cloned into MSCV-Puro-IRES-GFP (MSCV-PIG) (Addgene cat# 21654) (Mayr and Bartel, 2009 (link)) plasmid for retroviral overexpression of MYC in vitro. MSCV-PIG-MYC^T58A plasmid was confirmed by direct sequencing. For generation of high-titer virus, HEK-293T cells were transfected with a three-plasmid system including: MSCV-PIG (Addgene cat# 21654) with an empty vector or Myc T58A insert, pCMV-VSVG (Stewart et al., 2003 (link)), (Addgene cat# 8454), and pCMV delta R8.2 (Stewart et al., 2003 (link)) (Addgene cat# 8455). Viruses were harvested at 48 and 72 h post-transfection, concentrated by ultracentrifugation (24,000 x g for 1.45 h), and stored at −80°C until use. MYC^T58A was overexpressed in human cell lines (H889, H1963) or RPR2 primary cells through retroviral spinoculation. Spinoculation was performed at 37°C, 900 x g, for 75 min. During spinoculation, 0.5-1 million cells per well of a 6-well plate were cultured with 2 mL RPMI, 25 μL HEPES buffer (Thermo Fisher cat# 15630080), 8 μg/mL polybrene (Santa Cruz cat# sc-134220), and 25 μL retroviral MSCV-PIG or MSCV-PIG-MYC^T58A with titer >10⁶ infectious units/mL. Cells were selected 48 h after spinoculation with puromycin at a concentration of 1 μg/mL (H889) or 0.5 μg/mL (H1963, RPR2) until uninfected control cells were dead.

Ireland A.S., Micinski A.M., Kastner D.W., Guo B., Wait S.J., Spainhower K.B., Conley C.C., Chen O.S., Guthrie M.R., Soltero D., Qiao Y., Huang X., Tarapcsak S., Devarakonda S., Chalishazar M.D., Gertz J., Moser J.C., Marth G., Puri S., Witt B.L., Spike B.T, & Oliver T.G. (2020). MYC drives temporal evolution of small cell lung cancer subtypes by reprogramming neuroendocrine fate. Cancer cell, 38(1), 60-78.e12.

+ Open protocol

+ Expand

Stable Transfection of sPD-1 in PC3 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The HPV16-associated cervical cancer cell line, CaSki, and a HPV-negative epithelial cell line, PC3, were obtained from the China Center for Type Culture Collection (Wuhan, China). Cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% newborn calf serum (NBCS; Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin (North China Pharmaceutical Co., Ltd., Hebei, China) at 37°C in 5% CO₂. Purified plasmids MSCVPIG (Addgene, Cambridge, MA, USA) and MSCVPIG-sPD-1 (constructed in the lab) were stably transfected into PC3 cells (1×105/ml) using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. After 2 weeks, positive clones were selected based on their resistance to G418 (800 mg/ml; North China Pharmaceutical Co., Ltd.), which were analyzed by reverse transcription-polymerase chain reaction (RT-PCR), flow cytometry and western blot analysis.

Liu C., Lu J., Tian H., Du W., Zhao L., Feng J., Yuan D, & Li Z. (2017). Increased expression of PD-L1 by the human papillomavirus 16 E7 oncoprotein inhibits anticancer immunity. Molecular Medicine Reports, 15(3), 1063-1070.

+ Open protocol

+ Expand

Retroviral Transduction of Mouse TET2

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell lines were infected with retroviral vectors (pMSCV-PIG) containing either empty vector (EV) or a mouse TET2 full-length cDNA. pcDNA3-Tet2 (#60939) and MSCV PIG (Puro-IRES GFP) (#18751) were obtained from Addgene. Mm TET2 cDNA was subcloned from pcDNA3-Tet2 using SnaBI/NotI restriction sites, into adapted pMSCV-PIG (Puro-IRES-GFP) plasmid using HpaI/NotI restriction sites. Adapted pMSCV-PIG plasmid vector was modified with destroyed second EcoRI site and introduced NotI site and was a gift from Dr. Honglin Li, Augusta University. pMSCV-PIG-MmTET2 clone was verified via DNA sequencing. Briefly, Phoenix-Ampho cells were transfected using Lipofectamine 2000 (Invitrogen) with pMSCV-PIG plasmid. Virus particles were collected for spinoculation at 2400 rpm for 2 h at 32 °C. Upon selection of positive cells with 2–4 µg of puromycin, cDNA expression was detected using RT-qPCR for TET2.

Poole C.J., Lodh A., Choi J.H, & van Riggelen J. (2019). MYC deregulates TET1 and TET2 expression to control global DNA (hydroxy)methylation and gene expression to maintain a neoplastic phenotype in T-ALL. Epigenetics & Chromatin, 12, 41.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!