Dynamo colorflash sybr green master mix

The qPCR was performed in a CFX96 Real Time PCR Detection System (Bio-Rad), using 96-well white PCR plate (Thermo) sealed with ABsolute qPCR seals (Thermo). The reaction mix consisted of 7.5 μL of the DyNamo ColorFlash SYBR Green master mix (Thermo), 300 nM of each primer and 3 μL of the 1:10 diluted cDNA in a final volume of 15 μL. The PCR reaction cycle was: initial denaturation for 7 min at 95°C, followed by 40 cycles of 10 seconds at 95°C and 30 seconds at 60°C. A melting curve was performed at the end of the qPCR run, increasing the temperature in a stepwise fashion by 0.5°C every 5 seconds, from 65°C to 95°C. Each RT-qPCR reaction was performed in technical triplicate. Two control samples were included for each primer pair tested; the no template control (NTC) and T. versatilis genomic DNA. For each sample, a ValidPrime Assay (VPA), consisting of a pair of primers that bind to a non-transcribed intergenic region identified from RNA-seq data, was also included to detect and quantify the presence of contaminating gDNA [47 (link)]. The primers for the VPA were; 5′ACCGAATGGCACCGAGTTGG 3′ and 5′AATGGAGGAAGCGTGCCGTG 3′. As gDNA contamination rarely exceeded 1%, the RT-qPCR data were directly analysed using the CFX Manager software (Bio-Rad).

qPCR was performed in technical triplicate for each sample on a CFX Connect Real-Time Detection System (Bio-Rad, Hercules, California, USA) or 7500 Real Time PCR System (Thermo Fisher Scientific, Waltham, Massachusetts, USA), using DyNAmo ColorFlash SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, Massachusetts, USA) or Hot FIREPol EvaGreen qPCR Mix Plus (Solis BioDyne, Tartu, Estonia), respectively. The transcript of 60S ribosomal protein L13a gene (rpl13a) served as an internal reference to normalize the mRNA levels in different samples. The rpl13a mRNA expression level was not affected by the exercise or at any stage during development. The primers are listed in Table 1. Reaction conditions were as follows: initial denaturation at 95^°C for 10 min, 40 cycles of denaturation at 95^°C for 15 s, annealing and elongation at 60^°C for 20 s when SYBR Green was used, and annealing at 60^°C for 32 s followed by 20 s of elongation at 72^°C when EvaGreen chemistry was used. Amplification was followed by the melting curve/dissociation analysis. The qPCR data were analyzed using the 2^(−ΔΔCt) method.

Cellular and viral mRNA were extracted from cells using QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer’s recommendations. Genomic DNA was lysed and cDNA was synthesized from the extracts’ mRNA with random hexamer primers, using the Superscript IV VILO Mastermix with ezDNAse enzyme (Thermo Scientific) according to the manufacturer’s instructions. 4 µL of cDNA product were amplified with 0.6 µM of paired primers (presented in Supplementary Table S5) and Dynamo ColorFlash SYBR green mastermix (Thermo Scientific) according to the manufacturer’s recommendations, on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad), following the recommended protocol. mRNA quantification was then realized using the 2^−ΔΔCT method with Pfaffl correction^{43 (link)}.