Sybr green pcr premix ex taq 2 reagents

Manufactured by Takara Bio

Sourced in Japan

SYBR Green PCR Premix Ex Taq II is a pre-mixed reagent for real-time quantitative PCR (qPCR) analysis. It contains all the necessary components, including SYBR Green I dye, DNA polymerase, and buffer, to perform qPCR reactions.

Automatically generated - may contain errors

Lab products found in correlation

Total rna miniprep kit, by Corning (2 mentions) Cdna synthesis kit, by Takara Bio (2 mentions) Mir x mirna first strand synthesis kit, by Takara Bio (1 mentions) M5 hiper universal plus rna mini kit, by Mei5 Biotechnology (1 mentions) Ag490 gen, by Merck Group (1 mentions) Interleukin 6 (il 6), by Merck Group (1 mentions) Tnf α, by R&D Systems (1 mentions) Lightcycler 480 2, by Roche (1 mentions) Lightcycler 480 2 real time system, by Roche (1 mentions)

Close spelling variants of this product

SYBR Green PCR Premix Ex TaqTM II reagents (4 citations) SYBR® Premix Ex TaqTM II reagent (8 citations) SYBR Premix Ex Taq II reagent (67 citations) Premix Ex Taq SYBR Green PCR (17 citations) SYBR Green Premix Ex Taq II (110 citations) SYBR Green Premix Ex TaqTM II (9 citations) SYBR Green (SYBR Premix Ex Taq II, (4 citations) PCR SYBR Premix Ex Taq II (4 citations) SYBR® Premix Ex TaqTM reagent (16 citations) SYBR Premix Ex Taq reagent (167 citations)

4 protocols using sybr green pcr premix ex taq 2 reagents

Quantitative Analysis of Inflammatory Markers

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

MH7A cells or primary synovial cells were pretreated with of CIN for 2 h, and then incubated for another 6 h with 10 ng/mL LPS. Total RNAs were isolated using the commercial total RNA miniprep kit (Axygen, USA), according to the manufacturer’s instructions. Each sample was reversely transcribed using the cDNA synthesis kit (TaKaRa, China), by following the manufacturer’s protocol. The primer sequences were used for real-time PCR as shown in Table 1. Real-time PCR was performed using SYBR Green PCR Premix Ex Taq II reagents (TaKaRa) on a Light Cycler 480 II real-time system (Roche, USA), with GAPDH serving as house-keeping gene for normalization [25 (link)].

Table 1

Primer sequences for real-time PCR

Gene	Forward primer (5′ → 3′)	Reverse primer (5′ → 3′)
IL-6	CCTGACCCAACCACAAATGC	ATCTGAGGTGCCCATGCTAC
IL-8	GGTGCAGTTTTGCCAAGGAG	TTCCTTGGGGTCCAGACAGA
TNF-α	CCCCAGGGACCTCTCTCTAATC	GGTTTGCTACAACATGGGCTACA
GAPDH	GGAGTCCACTGGCGTCTT	AGGCTGTTGTCATACTTCTCAT

Meng X., Cheng W., Zhong S., Zhang P., Qin L, & Wang X. (2020). Anti-inflammatory effects of Jingshu Keli capsule and its components on human synoviocyte MH7A cells. Arthroplasty, 2, 7.

+ Open protocol

+ Expand

qRT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from PBMCs or cultured cells using M5 Hiper Universal Plus RNA Mini Kit (Mei5 Biotechnology, China). cDNA was synthesized using the cDNA synthesis kit or Mir-X miRNA First-Strand Synthesis Kit (both TaKaRa, Japan). Primers for qRT-PCR were designed via a public resource named PrimerBank (https://pga.mgh.harvard.edu/primerbank/) and synthesized by Sangon Biotech, which are listed in Table 3. qRT-PCR amplification was performed using SYBR Green PCR Premix Ex Taq™ II reagents (TaKaRa, Japan) with the Quant Studio 6 FlexI real-time PCR system (Applied Biosystems, USA), following the protocols from the commercial kits. Expression levels of tested genes were determined with the 2^-ΔCt or 2^-ΔΔCt method based on the endogenous control (GAPDH or U6).

Zhong S., Yang L., Liu N., Zhou G., Hu Z., Chen C, & Wang Y. (2022). Identification and validation of aging-related genes in COPD based on bioinformatics analysis. Aging (Albany NY), 14(10), 4336-4356.

+ Open protocol

+ Expand

Gene Expression Analysis of Cytokine-Induced Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

MH7A cells were seeded in 6-well plates at 1 × 10⁶ cells/well for 24 h. The cells were pretreated with AG490/GEN (Sigma–Aldrich) at indicated concentrations for 2 h and then stimulated with TNF-α (10 ng/mL; R&D Systems, Minneapolis, MN, USA) or IL-6 (50 ng/mL; Sigma–Aldrich) for 24 h. According to the manufacturer's instructions, total RNA of the cells was extracted using the commercial total RNA miniprep kit (Corning, Inc., Axygen, NY, USA). Then, each RNA sample was reverse transcribed using a complementary DNA (cDNA) synthesis kit according to the manufacturer's protocol. qPCR analysis was performed using SYBR Green PCR Premix Ex Taq II reagents (Takara Bio Inc., Kusatsu, Japan) on a Light Cycler 480 II real-time system (Roche, Mannheim, Germany). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), a house-keeping gene, was used for normalising the result of qPCR.

Cheng W.X., Huang H., Chen J.H., Zhang T.T., Zhu G.Y., Zheng Z.T., Lin J.T., Hu Y.P., Zhang Y., Bai X.L., Wang Y., Xu Z.W., Song B., Mao Y.Y., Yang F, & Zhang P. (2019). Genistein inhibits angiogenesis developed during rheumatoid arthritis through the IL-6/JAK2/STAT3/VEGF signalling pathway. Journal of Orthopaedic Translation, 22, 92-100.

+ Open protocol

+ Expand

Knee Cartilage Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cartilages of the right knee were obtained and stored in liquid nitrogen. Total RNA of the cartilage cells was isolated using a commercial total RNA mini-prep kit (Axygen, USA) according to the manufacturer’s instructions. Each sample was reverse transcribed using a cDNA synthesis kit (TaKaRa, Japan) according to the manufacturer’s protocol. Real-time PCR (RT-PCR) analysis was performed using SYBR Green PCR Premix Ex Taq II reagents (TaKaRa, Japan) on a Light Cycler 480 II real-time system (Roche, USA). PCR primer sequences are listed in Table 1. The housekeeping gene GAPDH was used for normalisation.Table 1

Forward and reverse primer sequences for RT-PCR.

Table 1

Gene	Forward Primer	Reverse Primer
TNF-α	GGCTGCCCCGACTACGT	AGGGCAAGGGCTCTTGATG
IL-1β	AAAGAAGAAGATGGAAAAGCGGTT	GGGAACTGTGCAGACTCAAACTC
IL-6	ATGGATGCTTCCAAACTGGAT	TGAATGACTCTGGCTTTGTCT
GAPDH	GAACATCATCCCTGCATCCA	GCCAGTGAGCTTCCCGTTCA

Cheng W., Gan D., Hu Y., Zheng Z., Zeng Q., Li L., Wang X., Zhang Y., Xu Z., Qin L, & Zhang P. (2021). The effect and mechanism of QufengZhitong capsule for the treatment of osteoarthritis in a rat model. Journal of Orthopaedic Translation, 28, 65-73.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!