Total RNA was extracted using Trizol reagent (Invitrogen). Mature miR‐205 expression was detected using a Hairpin‐it™ miRNA qRT‐PCR kit (Genepharma, Shanghai, China) in line with the manufacturer's instructions. Expression of RNU6B served as an endogenous control. NORAD expression was measured using the SYBR green qRT‐PCR assay (Takara Bio, Dalian, China). Expression of β‐actin was used as an endogenous control. The primers used were: NORAD, sense, CCTGGAAGGTGAGCGAAGT, anti‐sense, AGAGGGTGGTGGGCATTT; and β‐actin, sense, AGGGGCCGGACTCGTCATACT, anti‐sense, GGCGGCACCACCATGTACCCT. qRT‐PCR was performed at 95.0°C for 3 minutes, followed by 39 circles at 95.0°C for 10 seconds and 60°C for 30 seconds. Data were analyzed using the 2−ΔΔCT method.
Sybr green qrt pcr assay
Manufactured by Takara Bio
Sourced in China
The SYBR green qRT-PCR assay is a laboratory tool used for the quantitative measurement of RNA expression levels. It employs the SYBR green dye, which binds to double-stranded DNA, to detect and quantify target RNA sequences in real-time during the reverse transcription and polymerase chain reaction (RT-PCR) process.
Automatically generated - may contain errors
Lab products found in correlation
7 protocols using sybr green qrt pcr assay
1
Quantifying NORAD and miR-205 Expression
2
miR-381 and LRRC4 Expression in PC12 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After transfection for 48 h, the total RNA was extracted from PC12 cells with TRIzol reagent (Invitrogen Life Technologies, Carlsbad, USA). 500 ng RNA was reverse-transcribed into cDNA with Primer Script RT reagent kit (Takara Bio, Inc., Otsu, Japan). The mRNA expression was measured using a SYBR-Green qRT-PCR assay (Takara Bio, Inc.). The cycle number at which the reaction crossed an arbitrarily placed threshold was measured for each gene. GAPDH was used as a control for standardization. The primer sequences were as follows:
miR-381 (forward: 5′-AGTCTATACAAGGGCAAGCTCTC-3′ and reverse: 5′-ATCCATGACAGATCCCTACCG-3′);
LRRC4 (forward: 5′-AAGCTCTTGCTGTACCTTGTCCTT-3′ and reverse: 5′-TCATATTTGAGTTTCCTGTACCTTGTCCTT -3′);
GAPDH (forward: 5′-CATACAAGGTCATCTCCAACGC-3′ and reverse: 5′-AAGGTCCGTCAACAGTCTTCTG-3′); U6 (forward: 5′- GTGACCTTTATTGCG ACATCCACT -3′ and reverse: 5′- CTTCTGAAACAC GAGTCATATGTG GT -3′). Each group had three replicates, and the mean value of each experiment was calculated.
miR-381 (forward: 5′-AGTCTATACAAGGGCAAGCTCTC-3′ and reverse: 5′-ATCCATGACAGATCCCTACCG-3′);
LRRC4 (forward: 5′-AAGCTCTTGCTGTACCTTGTCCTT-3′ and reverse: 5′-TCATATTTGAGTTTCCTGTACCTTGTCCTT -3′);
GAPDH (forward: 5′-CATACAAGGTCATCTCCAACGC-3′ and reverse: 5′-AAGGTCCGTCAACAGTCTTCTG-3′); U6 (forward: 5′- GTGACCTTTATTGCG ACATCCACT -3′ and reverse: 5′- CTTCTGAAACAC GAGTCATATGTG GT -3′). Each group had three replicates, and the mean value of each experiment was calculated.
3
Quantifying miR-125b and LINC00152 Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen, CA, USA) was used for extracting total RNA from cells and tissues. A Hairpin‐it TM miRNAs qPCR kit (Genepharma, Shanghai, China) was used to measure miR‐125b levels according to the manufacturer's instructions. The expression of LINC00152 was assessed by SYBR green qRT‐PCR assay (Takara, Dalian, China), and β‐actin was used as an endogenous control. The primers were used as follows: LINC00152, sense, TGAGAATGAAGGCTGAGGTGT, antisense, GCAGCGACCATCCAGTCATT; β‐actin, sense, AGGGGCCGGACTCGTCATACT, antisense, GGCGGCACCACCATGTACCCT. The primers of miR‐125b and U6 were obtained from FUNENG(Guangzhou, China). qRT‐PCR was performed at the following conditions: 95.0°C for 3 minutes and 39 circles of 95.0°C for 10 seconds followed by 60°C for 30 seconds. Data were processed using 2−ΔΔCT method.
4
NKILA gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissue samples or cell lines using TRIzol reagent (Invitrogen, USA) following the manufacturer's protocol. Then the reverse transcription was performed using the iScript™ cDNA Synthesis Kit (Bio-Rad, China) according to the manufacturer's instruction. The expression level of NKILA was measured by SYBR green qRT-PCR assay (Takara, China). The primers (Tsingke, China) were as follows: NKILA forward 5'-AACCAAACCTACCACAACG-3' and reverse 5'-ACCACTAAGTCAATCCCAGGTG-3'; GAPDH forward 5'- CCTGGTATGACAACGAATTTG-3' and reverse 5'-CAGTGAGGGTCTCTCTCTTCC-3'.
5
Quantification of miR-573 and Bax Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol Reagent (Invitrogen, USA) in accordance with the protocol of the manufacturer. cDNA was synthesized using the QuantiTect reverse transcription kit (Qiagen). The Hairpin-itTM miR-573 qRT-PCR Primer Set (GenePharma Co., Ltd., Shanghai, China) was used to determine the relative quantity of miR-573, and the mRNA level of miR-573 was normalized to the expression of endogenous U6. Bax was measured by SYBR green qRT-PCR assay (Takara), and GAPDH was detected as an endogenous control. The primers used in our study were as follows: miR-573 forward, 5′-ACACTCCAGCTGGGCTGAAGTGATGTGTAA-3′ and reverse, 5′-TGGTGTCGTGGAGTCG-3′; Bax forward, 5′- CCCGAGAGGTCTTTTTCCGAG-3′ and reverse, 5′- CCAGCCCATGATGGTTCTGAT-3′; U6 forward, 5′- CCCCTGGATCTTATCAGGCTC-3′ and reverse, 5′- GCCATCTCCCCGGACAAAG-3′; GAPDH forward, 5′- GGAGCGAGATCCCTCCAAAAT-3′ and reverse, 5′- GGCTGTTGTCATACTTCTCATGG-3′. Quantitative measurements were determined using the 2−-ΔΔCq method [21 (link)].
6
Quantifying miRNA and Bcl2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol Reagent (Invitrogen, USA) was used to isolate total RNA according to the manufacturer’s protocol. The QuantiTect reverse transcription kit (Qiagen) was used to synthesize cDNA. The Hairpin-itTM miR-424-5p qRT-PCR Primer Set (GenePharma Co., Ltd., Shanghai, China) was used to detect the expression of miR-424-5p, and U6 was the reference gene. Bcl2 was detected by using SYBR green qRT-PCR assay (Takara), and GAPDH was the endogenous control. The primers were as follows: Bcl2 forward, 5′-GGTGGGGTCATGTGTGTGG-3′ and reverse, 5′-CGGTTCAGGTACTCAGTCATCC-3′; U6 forward, 5′- CCCCTGGATCTTATCAGGCTC-3′ and reverse, 5′- GCCATCTCCCCGGACAAAG-3′; and GAPDH forward, 5′- GGAG CGAGATCCCTCCAAAAT-3′ and reverse, 5′- GGCTGTTGTCATACTTCTCATGG-3′. Quantitative measurements were evaluated using the 2-ΔΔCt method.
7
RNA Extraction and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNAs from tissue samples and cells were extracted by using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. Gene expression were determined by SYBR green qRT-PCR assay (Takara, Dalian, People’s Republic of China), and GAPDH was used as an internal control. The relevant gene expression levels were calculated by using 2−ΔΔCT method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!