Cfx96 qrt pcr detection system

Total RNA was extracted from goat testisand cultured SSCs using RNAiso (TaKaRa, Biotech. Co. Ltd., Dalian, China). Total RNA was reverse transcribed into cDNAs using the Reverse Transcriptase reagent kit according to the manufacturer's instructions (Thermo Scientific, FL33407, USA). QRT-PCR was performed on a CFX96 QRT-PCR detection system (Bio-Rad, CA 94547, USA) according to the instructions for the BioEasy SYBR Green I RT-qPCR kit (Bioer Co. Ltd., Hangzhou, China). The QRT-PCR was performed as described previously [26 (link)]. The relative expression levels of the target genes were normalized to Gapdh expression for each sample. The relative expression levels were calculated using 2^−ΔΔCt. The primers for the validated mRNAs are listed in S2 Text.

Total RNA of cultured cells or clinical NSCLC specimens was extracted using TRIzol (Invitrogen, San Diego, CA) according to the manufacturer's instructions. We first measured the quantity of mRNA as described previously.16 First‐strand cDNA was generated by MMLV transcriptase (Promega, Madison, WI). Quantitative reverse transcription (qRT)‐PCR was performed on a CFX96 qRT‐PCR detection system (Bio‐Rad, Richmond, CA, USA). The sequences of the primers are listed in Table S5.

Synovium tissues were harvested at 35 days postoperatively. Total RNA was extracted from these tissues and mRNA levels determined by qRT-PCR. For this purpose, equal amounts of RNA were subsequently transcribed into the first-strand cDNA, then amplified in the presence of specific primers (Table1) and SYBR Green/ROX qPCR Master Mix. GAPDH was included as an internal loading control. Reactions were conducted in a CFX96 qRT-PCR detection system (Bio-Rad). The specific amplification of the interest gene was validated by the melting curve. The relative gene expression was derived from the CT values of the amplification curve using the 2^−ΔΔCт method.Table 1

Primers used for qRT-PCR determinations

Gene	species	GenBank ID	Strand	Sequence 5′–3′
IL-1β	Rabbit	NM_001082201.1	Forward	GCC GAT GGT CCC AAT TAC AT
			Reverse	ACA AGA CCT GCC GGA AGC T
MMP-3	Rabbit	NM_001082280.1	Forward	GCC AAG AGA TGC TGT TGA TG
			Reverse	AGG TCT GTG AAG GCG TTG TA
GAPDH	Rabbit	NM_001082253.1	Forward	GGAGGCAGGGATGATGTTCT
			Reverse	TGTTTGTGATGGGCGTGAA

The total RNA of the cells was isolated using Trizol (Invitrogen), following the manufacturer's instructions. For qRT-PCR analysis, the total RNA was treated with DNase I for 10 min, and the SYBR Prime Script qRT-PCR Kit (TaKaRa) was used for qRT-PCR detection. Primers were designed (Table 1) for duck FST, PI3K, Akt, mTOR, S6K, FoxO1, MuRF1, MSTN and ACVR2. GADPH (AY436595) and β-actin (EF667345) were used as the two reference genes. The reactions were carried out using the CFX96™ qRT-PCR Detection System (Bio-Rad) in 96-well plates, and the mixtures contained 1 μl of cDNA template, 12.5 μl of SYBR Premix ExTaq, 10.5 μl of sterile water and 0.5 μl of each gene-specific primer. The procedure included 30 s of a pre-denaturation reaction at 95°C, followed by 40 cycles of 95°C for 10 s and 60°C for 40 s. Each sample was repeated in triplicate. The Vandesompele method of quantification was used to calculate the expression of the target genes relative to the internal control genes.

qPCR was used to analyze the expression levels of the genes in the two groups. Total RNA was extracted from spinal cord tissue using TRIzol (Takara, Japan). The purity and quantity of the RNA were assessed on an ultraviolet spectrophotometer (SYNERGY H1, BioTek, USA) and the expression of circRNAs, mRNAs, and GAPDH were evaluated with PrimeScript RT Master Mix (Takara, Japan), SYBR Premix Ex Taq II kits (Takara, Japan), and a CFX96 qRT-PCR Detection System (Bio-Rad, USA). Levels of miRNAs and U6 expressed were measured with a bulge-Loop miRNA qRT-PCR Starter Kit (RiboBio, Guangzhou, China). The qPCR parameters were as follows: 95 °C for 30 s(pre-denaturation), followed by 40 cycles (amplification) of 95 °C for 15 s (denaturation), 60 °C for 30 s (annealing), and 60 °C for 30 s (extension). Experiments were performed in triplicate, with GAPDH as a control for mRNAs and circRNAs, while U6 served as a control for miRNAs. The 2^–ΔΔCT method was used for comparative quantitation. CircRNA covalent loop structures were confirmed through Sanger sequencing. The primers used are listed in Supplementary Table 1.

Methylated DNA was enriched using MethylMiner™ Methylated DNA Enrichment Kit (Invitrogen) according to the manufacturer's instructions. Briefly, 2 μg of genomic DNA was fragmented by sonication. Methylated DNA was enriched by binding to magnetic beads coated with the methyl-CpG-binding domain of the human MBD2 protein (Methyl-CpG Binding Domain Protein 2) and eluted as a single fraction using 2 M NaCl. Finally, the DNA was ethanol-precipitated and resuspended in 50 μL of DNase-free water. For q-PCR, iQTM SYBR® Green supermix and CFX96 q-RT-PCR detection system (Bio-Rad Laboratories Inc.) were used. The sequences of the primers used in the q-PCR were: miR-193b_DMR_f1 5’-TGGCGTTTCTGG TTTCTCTT-3’ and miR-193b_DMR_r2 5’-CGCACCTTTTCTCCTCATTT-3’. Each sample was run in duplicate. The methylation status of miR-193b was calculated from the elution-fraction signal in relation to the total q-PCR signal.

Raw264.7 cells were spread in six-well plates at 2 × 10⁵ per well, and after attachment, an inhibitor (LY294002, MCE) was added to the inhibitor group, and after half an hour, berberine was added for pretreatment, and after 3 h, LPS was added and stimulated for 24 h. The mRNA of the Raw264.7 cells was assessed with a TRIeasy™ Total RNA Extraction Reagent (YEASEN, Shanghai, China), and the cDNA was obtained with Reverse Transcription Kit (YEASEN, Shanghai, China). qRT-PCR was conducted on a CFX96 qRT-PCR detection system (Bio-Rad, Hercules, CA, USA) to obtain the cDNA. The mRNA levels of IL-6, IL-1β, and TNF-α were measured. The mRNA expression levels were assayed using the 2^−ΔΔCt comparison method with an internal control gene (β-actin) as the standard. The primer sequences are summarized in Table 1 [50 (link)].