Facsaria iiiu cell sorter

Blood (1,000 μL) was collected at necropsy and incubated with 13 mL of ACK lysis buffer (A1049201, GIBCO) for five minutes at room temperature to lyse red blood cells. Cell pellets were washed twice with PBS and resuspended in 300 μL of PBS containing 2% FBS and analyzed for the number of YFP⁺ cells by flow cytometry (BD FACSAria IIIu Cell Sorter).

HEK293T DHX30-deficient cells were generated by transfecting a plasmid (pLentiCRISPR v2, GenScript, #52961) encoding a single guide RNA (CGAGTGCTAGCTGATCGCTT) targeting exon 7, the Cas9 endonuclease and a puromycin resistance gene under the control of the EFS promoter. Cells were transfected with TurboFect transfection reagent (Thermo Scientific) and treated with puromycin for 3 days. Surviving cells were then subjected to single cell sorting using BD FACSAria™ IIIu Cell Sorter (BD Biosciences). Single-cell clones were grown in 96-well plates for two weeks and then expanded into 6 well dishes. DHX30 knockout efficiency was assessed by Western blotting using an anti-DHX30 rabbit polyclonal antibody (Bethyl, #A302-218A) (1:500).

The ratiometric sensor Grx1-roGFP3 was used to analyse the variation in the glutathione redox potential (E_GSH). Grx1-roGFP3 was kindly donated by Dr. Manfred Frey (Steinbeis-Innovationszentrum Zellkulturtechnik, C/O University of Applied Sciences Mannheim, Germany). In brief, Grx1-roGFP3 was synthesised using the GENWIZ service from Sigma Aldrich and cloned into pHR’SIN-cPPTSEW [113 (link)] via the BamHI and XbaI restriction sites. Lentivirus particles were produced as previously described [114 (link)]. A stock of pHRSINGrx1-roGFP3 was prepared and stored at −80 °C. Subsequently, 50 µL of lentivirus was added to a T25 flask at 50% confluence of primary and expandable cells and then incubated at 37 °C in a 5% CO₂ atmosphere for 24 h. The cells were washed with 1× Dulbecco’s phosphate-buffered saline (DPBS, Biozym Scientific, Hessisch Oldendorf, Germany), and fresh Dresden medium was added. This step was repeated after 12 h. Afterwards, the cells were sorted for 80% of positive GFP signal at 4 °C using a BD FACSAria™ IIIu cell sorter (BD Life Sciences, San Jose, CA, USA) and the corresponding BD FACSDiva 8.0.2 software. Vector stability over passages was confirmed by a qualitative evaluation of GFP using the Carl Zeiss Axio Vert. A1 microscope (431030-9040-000; Jena, Germany). No changes in the GFP expression were observed up to three passages after transfection.

CpG-proB cells were isolated from C57BL/6J BM cell cultures activated with 1 μM CpG-1668 (CpG-B) (Eurogentec, Angers, France) for 17h in low endotoxin-RPMI medium (Fisher Scientific, Illkirch, France) supplemented with 10% (vol/vol) FCS and 1% antibiotics (penicillin and streptomycin). c-kit⁺ cells were magnetically sorted using the Robosep automaton (StemCell Technologies, Grenoble, France) and thereafter stained with appropriately labeled mAbs and sorted by flow cytometry on a BD FACS Aria IIIu cell-sorter as c-kit⁺Sca-1⁺B220⁺PDCA-1^-IgM^- cells. Electronically sorted B-cell progenitors were cultured on plates at 20,000 cells/ml over OP-9 stromal cells in OPTIMEM medium (Gibco) supplemented with 10% FCS, 1% antibiotics, 0.1% β-mercaptoethanol and 20 ng/ml Flt3L, SCF (Immunotools, Frisoythe, Germany) and IL-7 (Peprotech France, Neuilly-sur-Seine, France), achieving on average a 10-fold expansion of sorted CpG-proBs over 6 days. Expanded CpG-proBs were further stained and electronically sorted as c-kit^low/- Sca-1⁺B220⁺PDCA-1^-IgM^- cells, routinely assessed as >95% pure, before i.v. injection through the retro-orbital sinus.

Apoptotic cells were identified using an Annexin V-FITC/PI apoptosis detection kit (Nacalai Tesque, Kyoto, Japan), following the manufacturer’s protocol. Cells were washed with PBS and resuspended in 100 µL of Annexin V binding solution, followed by adding 5 µL of Annexin V-FITC and 5 µL of propidium iodide and incubation for 15 min at room temperature. Flow cytometry was performed using a BD FACSAria IIIu cell sorter (BD Biosciences, San Jose, CA, USA) after stained cells were washed and resuspended in 500 µL of Annexin V binding solution.

YFP⁺ cells were single-cell sorted at the South Campus Flow Cytometry core (BD FACSAria IIIu Cell Sorter). RNA was isolated using either Trizol or PicoPure RNA isolation kit (Applied Biosystems). Total RNA was quantified using an RNA6000 Pico or Nano assays (Aligent), whole transcriptome analysis was performed using the WT Plus Assay (Applied Biosystems) and run using the Mouse Clariom D array (Applied Biosystems) by the MDACC Sequencing and ncRNA Core Program. Gene expression analysis was performed using the TAC4.0 version 2 software. Gene set enrichment analysis (GSEA) was performed for KEGG, biocarta, c5bp, and hallmarks gene sets using GSEA software version 4.0.0 and MSigDB 7.0 (Broad Institute). Gene expression microarray data have been deposited in GEO: GSE164612. Ingenuity pathway analysis (QIAGEN) was run on the expression values of the primary cancer cells using 2.1 fold and p < 0.05 as cutoffs.