Scrambled control sirna

Manufactured by OriGene

Sourced in United States

Scrambled control siRNA is a non-targeting small interfering RNA (siRNA) designed to serve as a control for siRNA experiments. It does not target any known gene and is used to assess the effects of siRNA delivery and the RNAi pathway without interfering with specific gene expression.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (4 mentions) Amaxa cell line nucleofector kit 5 for monocytic cells, by Lonza (3 mentions) Scrambled control sirna, by Santa Cruz Biotechnology (2 mentions) Opti mem, by Thermo Fisher Scientific (2 mentions) Amaxa noclecfector kit 5 for thp 1, by Lonza (2 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions) Hif 1α sirna, by Santa Cruz Biotechnology (1 mentions) Dharmafect 1, by Thermo Fisher Scientific (1 mentions) Lipofectamine 3000rnaimax, by Thermo Fisher Scientific (1 mentions) Stat3 sirna sc 29493, by Santa Cruz Biotechnology (1 mentions) Sirna acsl1, by OriGene (1 mentions) Tib 67, by American Type Culture Collection (1 mentions) Opti mem serum free medium, by Thermo Fisher Scientific (1 mentions) Interferin sirna transfection reagent, by Polyplus Transfection (1 mentions) Trilencer 27, by OriGene (1 mentions) Amaxa nucleofector kit 5, by Lonza (1 mentions) Sirna cerk, by OriGene (1 mentions) Viromer blue, by BioNTech (1 mentions) Pmaxgfp, by Lonza (1 mentions)

Close spelling variants of this product

Control siRNA (19 citations) SiRNAs (15 citations) Scrambled siRNA (13 citations) Scrambled control (3 citations) Scrambled siRNA controls (2 citations)

18 protocols using scrambled control sirna

Knocking Down GRP78 in Chondrocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three small interfering RNAs (siRNAs) against GRP78 (siRNA‐1: rArGrArUrCrGrGrArGrArUrArArArGrArGrArArGrCrUrGGG, siRNA‐2: rArGrArUrArGrArUrGrUrGrArArUrGrGrUrArUrUrCrUrUCG, and siRNA‐3: rGrUrGrArCrArCrCrArArUrArArArUrGrUrUrUrGrUrUrATT) were designed and synthesized to target GRP78 by Origene Co. Ltd. (USA). Chondrocytes were transfected with the three siRNAs that target GRP78 using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions. The chondrocytes were also transfected with a control scrambled siRNA (Origene, USA) targeting a sequence that shared no homology with the rat genome (negative control, NC). Western blot analysis was used to evaluate the suppression rates of the siRNAs after transfection for 24 h. Then, following 24 h treatment with TM, the expression levels of two proteins related to autophagy (LC3B and Beclin‐1) were analyzed by western blotting, and autophagosome formation was observed via TEM as described above.

Wu H., Meng Z., Jiao Y., Ren Y., Yang X., Liu H., Wang R., Cui Y., Pan L, & Cao Y. (2020). The endoplasmic reticulum stress induced by tunicamycin affects the viability and autophagy activity of chondrocytes. Journal of Clinical Laboratory Analysis, 34(10), e23437.

+ Open protocol

+ Expand

Knockdown of CD46 in CD8+ T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

siRNAs targeting CD46 mRNA and control scrambled siRNA were purchased from Origene (Rockville, MD, USA) and delivered at a final concentration of 15 nM (with a mixture of three different siRNA at 5 nM each or scramble control at 15 nM) into primary human CD8⁺ T cells by transfection with Lipofectamine RNAiMAX (Life Technologies, Paisley, UK) following the manufacturer’s instructions in the presence of 50 ng/mL of recombinant human IL-15 and activating antibodies to CD3 (0.25 μg/mL) and CD28 (2 μg/mL) for 48 h.

Arbore G., West E.E., Rahman J., Le Friec G., Niyonzima N., Pirooznia M., Tunc I., Pavlidis P., Powell N., Li Y., Liu P., Servais A., Couzi L., Fremeaux-Bacchi V., Placais L., Ferraro A., Walsh P.R., Kavanagh D., Afzali B., Lavender P., Lachmann H.J, & Kemper C. (2018). Complement receptor CD46 co-stimulates optimal human CD8+ T cell effector function via fatty acid metabolism. Nature Communications, 9, 4186.

+ Open protocol

+ Expand

Silencing C5aR1 in Primary CD4+ T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

SiRNA targeting human C5AR1 mRNA and control scrambled siRNA were purchased from Origene (Rockville, MD) and delivered at a final concentration of 15 nM (mixture of three different C5aR1 siRNA used at 5 nM each or scramble control at 15 nM) into primary human CD4⁺ T cells by transfection with Lipofectamine RNAiMAX (Life Technologies) following the manufacturer's instructions. C5AR1 mRNA level reduction was consistently about 30%.

Arbore G., West E.E., Spolski R., Robertson A.A., Klos A., Rheinheimer C., Dutow P., Woodruff T.M., Yu Z.X., O'Neill L.A., Coll R.C., Sher A., Leonard W.J., Köhl J., Monk P., Cooper M.A., Arno M., Afzali B., Lachmann H.J., Cope A.P., Mayer-Barber K.D, & Kemper C. (2016). T helper 1 immunity requires complement-driven NLRP3 inflammasome activity in CD4+ T cells. Science (New York, N.Y.), 352(6292), aad1210.

+ Open protocol

+ Expand

siRNA Transfection for KLF5 and HIF-1α

Check if the same lab product or an alternative is used in the 5 most similar protocols

KLF5 siRNA, and scrambled control siRNA were purchased from OriGene (Rockville, MD, USA). HIF-1α siRNA, and scrambled control siRNA were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Cells were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) for 6 h, following which the lipid and siRNA complex was removed and fresh growth medium was added. After 48 h of transfection, cells were used for immunoblotting.

Pratheeshkumar P., Siraj A.K., Divya S.P., Parvathareddy S.K., Siraj S., Diaz R., Begum R., Al-Sobhi S.S., Al-Dayel F, & Al-Kuraya K.S. (2021). Prognostic Value and Function of KLF5 in Papillary Thyroid Cancer. Cancers, 13(2), 185.

+ Open protocol

+ Expand

Lrrc2 Knockdown in H9c2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

H9c2 cells (100,000 cells/well) were seeded in a 12-well plate. The following day, cultures (n = 5) were transfected with either a Lrrc2-specific or a non-targeting scrambled control siRNA (Origene). For a given transfection, 5μl DharmaFECT1 and 95μl opti-MEM (Invitrogen) were mixed in one tube whilst 2.5μl of the Lrrc2-targeting or control siRNA (20μM) was mixed with 97.5μl opti-MEM in a second tube. Following a 5 minute incubation at room temperature, solutions were mixed and left at room temperature for a further 20 minutes. After the allotted time, cells received 800μl fresh media (DMEM supplemented with 10% heat-inactivated FBS and 1% penicillin/streptomycin) followed by the above transfection mixtures. The final concentration of siRNA was 50nM. Knockdown efficacy was assessed via QPCR (Forward: AGTGCACGAGTCAAGGACAG; Reverse: TTGAGGTGTGTCTGTTCCTTC) 2–3 days post-transfection and was found to be at least 75%.

McDermott-Roe C., Leleu M., Rowe G.C., Palygin O., Bukowy J.D., Kuo J., Rech M., Hermans-Beijnsberger S., Schaefer S., Adami E., Creemers E.E., Heinig M., Schroen B., Arany Z., Petretto E, & Geurts A.M. (2017). Transcriptome-wide co-expression analysis identifies LRRC2 as a novel mediator of mitochondrial and cardiac function. PLoS ONE, 12(2), e0170458.

+ Open protocol

+ Expand

Knockdown of p300 in Jurkat Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three million Jurkat CD4⁺ T cells were transfected with 30 nM scrambled control siRNA or p300-specific siRNA (OriGene) using Lipofectamine 2000 (Invitrogen, Life Technologies). Cells were collected after overnight culture (24 h) and processed for mRNA analysis as indicated in the qRT-PCR section.

Hofmann S.R., Mäbert K., Kapplusch F., Russ S., Northey S., Beresford M.W., Tsokos G.C, & Hedrich C.M. (2019). cAMP response element modulator α induces dual specificity protein phosphatase 4 to promote effector T cells in juvenile-onset Lupus. Journal of immunology (Baltimore, Md. : 1950), 203(11), 2807-2816.

+ Open protocol

+ Expand

Transient CHD4 Knockdown in PTC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

PTC cell lines were transiently transfected with CHD4 siRNA and scrambled control siRNA (OriGene, Rockville, MD, USA) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Six hours post transfection, lipid-siRNA complex was replaced with fresh growth medium. After 48 h of transfection, knockdown efficiency was confirmed by immunoblotting.

Pratheeshkumar P., Siraj A.K., Divya S.P., Parvathareddy S.K., Alobaisi K., Al-Sobhi S.S., Al-Dayel F, & Al-Kuraya K.S. (2021). CHD4 Predicts Aggressiveness in PTC Patients and Promotes Cancer Stemness and EMT in PTC Cells. International Journal of Molecular Sciences, 22(2), 504.

+ Open protocol

+ Expand

Transfection of HMEpC cells with siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

HMEpC (3 × 10⁵) cells were plated in 8‐chamber slides and transfected with three independent anti‐a2V siRNA (a) rGrCrCrUrUrArUrGrArCrArUrArGrCrCrArArArUrArArUTC, (b) rArCrArArGrGrUrUrArArGrArArGrArUrArUrGrUrGrArUTG, and (c) rArGrCrUrGrUrCrArArArUrCrArArGrArUrGrArUrGrGrGAA) and scrambled control siRNA (OriGene, Rockville, MD, USA). Lipofectamine 3000 RNAiMAX (Invitrogen) was used as a transfection reagent according to the manufacturer's instructions.

Katara G.K., Kulshrestha A., Mao L., Wang X., Sahoo M., Ibrahim S., Pamarthy S., Suzue K., Shekhawat G.S., Gilman‐Sachs A, & Beaman K.D. (2017). Mammary epithelium‐specific inactivation of V‐ATPase reduces stiffness of extracellular matrix and enhances metastasis of breast cancer. Molecular Oncology, 12(2), 208-223.

+ Open protocol

+ Expand

TRIP4 and CELF1 Overexpression Rescue

Check if the same lab product or an alternative is used in the 5 most similar protocols

C2C12 were transfected with Trip4-specific siRNAs or scrambled control siRNA (Origene) 18 hours after seeding according to the manufacturer’s instructions using Lipofectamine RNAimax (Invitrogen). The final concentration of siRNAs was 4 nM. Maximum down-regulation was achieved 48h post transfection.
For rescue experiments, mammalian expression vectors (Promega) containing the ORF sequence of the human TRIP4 (pFN21AB7885) or CELF1 (pFN21AB0039) genes fused with a HaloTag were used. Cells were transfected with siRNAs as described above. A second transfection was performed to overexpress TRIP4 or CELF. Plasmids and Lipofectamine 2000 were mixed in Opti-MEM according to the manufacturer’s instructions (Invitrogen).

Villar-Quiles R.N., Catervi F., Cabet E., Juntas-Morales R., Genetti C.A., Gidaro T., Koparir A., Yüksel A., Coppens S., Deconinck N., Pierce-Hoffman E., Lornage X., Durigneux J., Laporte J., Rendu J., Romero N.B., Beggs A.H., Servais L., Cossée M., Olivé M., Böhm J., Duband-Goulet I, & Ferreiro A. (2019). ASC1 is a cell cycle regulator associated with severe and mild forms of myopathy. Annals of neurology, 87(2), 217-232.

+ Open protocol

+ Expand

Knockdown of KLF5 and STAT3 by siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

KLF5 siRNA (SR300482), and scrambled control siRNA were purchased from OriGene (Rockville, MD). STAT3 siRNA (sc-29493), and scrambled control siRNA were purchased from Santa Cruz Biotechnology, Inc (Santa Cruz, CA). Cells (2 × 10⁵) were seeded in 6 well plate and transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) for 6 h following which the lipid and siRNA complex was removed and fresh growth medium was added. After 48 h of transfection, cells were used for immunoblotting.

Siraj A.K., Pratheeshkumar P., Divya S.P., Parvathareddy S.K., Alobaisi K.A., Thangavel S., Siraj S., Al-Badawi I.A., Al-Dayel F, & Al-Kuraya K.S. (2020). Krupple-Like Factor 5 is a Potential Therapeutic Target and Prognostic Marker in Epithelial Ovarian Cancer. Frontiers in Pharmacology, 11, 598880.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!