Taqman reverse transcriptase kit

Manufactured by Roche

Sourced in United States

The TaqMan reverse transcriptase kit is a laboratory product designed for the process of reverse transcription, which involves the conversion of RNA into complementary DNA (cDNA). The kit contains the necessary components, including the reverse transcriptase enzyme, to perform this conversion efficiently.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (3 mentions) Collagenase 4 digestion buffer, by MP Biomedicals (2 mentions) Rneasy mini kit, by Qiagen (2 mentions) Prism 7000 sequence detection system, by Thermo Fisher Scientific (1 mentions) 7000 sequence detection system, by Thermo Fisher Scientific (1 mentions) Taqman probe, by Thermo Fisher Scientific (1 mentions) T100 thermal cycler, by Thermo Fisher Scientific (1 mentions) T100 thermal cycler, by Bio-Rad (1 mentions) Rneasy mini ki, by Qiagen (1 mentions) Agilent bioanalyser, by Agilent Technologies (1 mentions)

Spelling variants of this product

Reverse transcriptase (34 citations) Reverse transcriptase kit (24 citations) Taqman Reverse Transcriptase Reagent Kit (2 citations)

7 protocols using taqman reverse transcriptase kit

Isolation and Analysis of Dermal Lymphatic Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Dermal LECs were isolated from the abdominal skin by digestion in 0.4% Collagenase IV digestion buffer (MP Biomedicals, Solon, OH) and flow cytometry to sort for LECs (CD45⁻, CD31⁺, podoplanin⁺).(17 (link)) RNA was extracted using TRIZOL (Invitrogen, Life Technologies, Carlsbad, CA) and converted to cDNA with TaqMan reverse transcriptase kit (Roche, Branchburg, NJ). Relative gene expression between groups was analyzed by normalizing gene expression with GAPDH.(18 (link))

García Nores G.D., Cuzzone D.A., Albano N.J., Hespe G.E., Kataru R.P., Torrisi J.S., Gardenier J.C., Savetsky I.L., Aschen S.Z., Nitti M.D, & Mehrara B.J. (2016). Obesity but not high-fat diet impairs lymphatic function. International Journal of Obesity (2005), 40(10), 1582-1590.

+ Open protocol

+ Expand

Quantifying PIM Kinase Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cell lines using the RNeasy Mini Kit (Qiagen). cDNA was generated using the Taqman Reverse Transcriptase Kit (Roche). qRT-PCR was performed using an Applied Biosystems Prism 7000 Sequence Detection system with Taqman probes according to manufacturer specifications. Probes used were: Hs0165498_m1 (PIM1), Hs00179139_m1 (PIM2), Hs00420511_m1 (PIM3), and Hs02758991_g1 (GAPDH) for normalizing the data, using the 2^−ΔΔCT.

Peters T.L., Li L., Tula-Sanchez A.A., Pongtornpipat P, & Schatz J.H. (2016). Control of translational activation by PIM kinase in activated B-cell diffuse large B-cell lymphoma confers sensitivity to inhibition by PIM447. Oncotarget, 7(39), 63362-63373.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation by RNeasy® Mini Kit (QIAgen #74106); cDNA generated by Taqman® Reverse Transcriptase kit (Roche; #N808-0234) on a BioRad T100 Thermal Cycler. qRT-PCR employed an Applied Biosystems Prism® 7000 Sequence Detection System with Taqman probes (Life technologies): NPM-ALK (#Hs03024829_ft), CDKN2A (#Hs00923894_m1) and GAPDH as endogenous control (#Hs02758991_g1). Data was analyzed using the 2^{−Δ ΔCt} method.

Amin A.D., Rajan S.S., Liang W.S., Pongtornpipat P., Groysman M.J., Tapia E.O., Peters T.L., Cuyugan L., Adkins J., Rimsza L.M., Lussier Y.A., Puvvada S.D, & Schatz J.H. (2015). Evidence Suggesting that Discontinuous Dosing of ALK Kinase Inhibitors May Prolong Control of ALK+ Tumors. Cancer research, 75(14), 2916-2927.

+ Open protocol

+ Expand

Sequencing NPM-ALK Kinase Domain

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction (RNeasy^® Mini Ki; QIAgen) followed by cDNA synthesis (Taqman^® Reverse Transcriptase kit; Roche) was carried out two independent times for all resistant cell lines as well as their respective parental lines. The NPM-ALK fusion was PCR amplified (Primers - Forward: GTCCGCCTTCTCTCCTACCT, Reverse: TTGGCACAAAACAAAACGTG) on a BioRad T100 Thermal Cycler. The kinase domain was sequenced by Sanger sequencing. The sequences obtained for the resistant lines were aligned to their respective parental lines using the ClustalW online sequence alignment tool to identify base pair changes. The identified mutations were the same for both independent sets of sequencing.

Amin A.D., Li L., Rajan S.S., Gokhale V., Groysman M.J., Pongtornpipat P., Tapia E.O., Wang M, & Schatz J.H. (2016). TKI sensitivity patterns of novel kinase-domain mutations suggest therapeutic opportunities for patients with resistant ALK+ tumors. Oncotarget, 7(17), 23715-23729.

+ Open protocol

+ Expand

Isolation and Analysis of Dermal LECs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Dermal LECs were isolated from the abdominal skin by digestion in 0.4% Collagenase IV digestion buffer (MP Biomedicals, Solon, OH, USA) and flow cytometry to sort for LECs (CD45⁻, CD31⁺, podoplanin⁺).^{17 (link)} RNA was extracted using TRIZOL (Invitrogen, Life Technologies, Carlsbad, CA, USA) and converted into cDNA with TaqMan reverse transcriptase kit (Roche, Branchburg, NJ, USA). Relative gene expression between groups was analyzed by normalizing gene expression with GAPDH.^{18 (link)}

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction was performed on tail skin using TRIZOL (Invitrogen, Life Technologies) according the manufacturer's recommendations. RNA quality and quantity was assessed using an Agilent Bio Analyser (Agilent Technologies, Inc., Santa Clara, CA). The isolated RNA was converted to cDNA using a TaqMan reverse transcriptase kit (Roche, Branchburg, NJ) and relative expression of gene expression between groups was performed using delta–delta CT PCR analysis and normalizing gene expression using GAPDH RNA amplification as previously described68 (link). Relative expression was calculated using the formula: 2[−(Ct gene of interest−Ct endogenous control) sample A−(Ct gene of interest−Ct endogenous control) sample B)]. All samples were performed in triplicate. The primers used for the PCR targets of interest were for VEGF-C (Mm00437310_m1), TGF-β1 (Mm01178820_m1) and IFN-γ (Mm01168134; Applied Biosystems, Life Technologies).

Gardenier J.C., Kataru R.P., Hespe G.E., Savetsky I.L., Torrisi J.S., Nores G.D., Jowhar D.K., Nitti M.D., Schofield R.C., Carlow D.C, & Mehrara B.J. (2017). Topical tacrolimus for the treatment of secondary lymphedema. Nature Communications, 8, 14345.

+ Open protocol

+ Expand

Real-Time Cell Migration Monitoring

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell-substrate Impedance Sensing (ECIS; Applied BioPhysics Troy, NY, uSA), which is an impedance based method to study cell activities in tissue culture in real-time. We modified the protocol described by the company: 25,000 cells/cm 2 was seeded in ECIS arrays (8-well), and grown to about 100% confluency in approximately 24 h. The cells were then killed in a small active electrode. The additional fibrillar collagen was polymerized in each well at 0.25 mg/ml for 90 min. The migration was assessed by continuing impendent measurements for 20 h.
Quantitative qPCR. mRNA of p21 was examined by qPCR. cDNA was reverse transcribed using TaqMan reverse transcriptase kit (Roche) and qPCR was performed using the Roche Light-Cycler with SYBR Green dye (Roche) (24) . The following human primers were used: p21 FW: 5'-GAG GCCGGGATGAGTTGGGAGGAG, RV: 5'-CAGCCGG CGTTTGGAGTGGTAGAA; p53 FW: 5'-CCCCTCCT GGCCCCTGTCATCTTC, RV: 5'-GCAGCGCCTCAC AACCTCCGTCAT; GAPDH FW: 5'-AATCCCATCACC ATCTTCCA, RV: 5'-TGGACTCCACGACGTACTCA.
Statistics. Data are expressed as mean ± SD. The data in each experiment were performed with unpaired Student's t-tests using SPSS 13.0 software. The experiments were done a minimum of three times. P<0.05 was considered to indicate a statistically significant difference.

Shen Y.F., Wei A.M., Kou Q., Zhu Q.Y, & Zhang L. (2016). Histone deacetylase 4 increases progressive epithelial ovarian cancer cells via repression of p21 on fibrillar collagen matrices. Oncology reports, 35(2).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!