HL60 (human promyelocytic cell line), U937 (human monocytic cell line) and K562 (human chronic myelocytic leukemia cell line) cells were cultured using Iscove’s Modified Dulbecco’s Medium + 10% Fetal Bovine Serum. The pLKO.1_DDX41-shRNA and the control non-target shRNA were purchased from Sigma-Aldrich (St.Louis, MO, USA). In brief, 293T cells were transfected with shRNA targeting DDX41 or non-target shRNA control plasmid together with packing plasmid pCMVΔ8.2 and envelope plasmid containing VSV-G. Viral supernatants were harvested at 48, 72 and 96 hours post transfection, and target cells were infected in the presence of 8 μg/mL polybrene for 24 hours, and selected with puromycin (2 μg/mL for K562 and 1 μg/mL for HL60). For CD34+ primary cells, we used 25 μg/mL of Retronectin® instead of polybrene. Lentiviral expression vector (pLX304, Clone ID: HsCD00442077; DNASU Plasmid Repository) was used to generate viral supernatants. U937 was transfected in the presence of 8 μg/mL polybrene for 24 hours, then selected with blasticidin (5 μg/mL).
Non target shrna control
Manufactured by Merck Group
Sourced in United States
The Non-target shRNA control is a laboratory reagent used for assessing the effects of small hairpin RNA (shRNA) on gene expression. It serves as a negative control, providing a baseline for comparison to determine the specific effects of the target shRNA.
Automatically generated - may contain errors
Lab products found in correlation
Puromycin, by Merck Group (2 mentions)
Sh rnas, by Qiagen (1 mentions)
Peg 6000, by Merck Group (1 mentions)
Lentiviral packaging mix, by Merck Group (1 mentions)
Mission rnai system, by Merck Group (1 mentions)
Puromycin, by Bio Basic (1 mentions)
Hygromycin b, by Wisent (1 mentions)
Shcontrol, by Merck Group (1 mentions)
Sirnas, by Thermo Fisher Scientific (1 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Merck Group (1 mentions)
Rpmi 1640, by Merck Group (1 mentions)
Heat inactivated fbs, by Equitech-Bio (1 mentions)
Polybrene, by Merck Group (1 mentions)
11 protocols using non target shrna control
1
Lentiviral Transduction of Leukemic Cell Lines
2
Silencing Hif-1α in Primary Chondrocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MISSION® shRNA Lentiviral Transduction Particles against Hif-1α (CCGGTGGATAGCGATATGGTCAATGCTCGAGCATTGACCATATCGCTATCCATTTTTG) and control non-target shRNA were purchased from Sigma-Aldrich (St. Louis, MO). Primary chondrocytes were grown to 25–30% confluence and transduced with Hif-1α shRNA or scramble control lentivirus at a multiplicity of infection (MOI) of 10 by adding a pre-made viral particle stock solution (1.4 × 107) into 6-cm culture plates in the presence of 8 μg/ml of polybrene for 2 days, followed by puromycin selection (10 μg/ml) for 3–5 days as previously described43 (link). The puromycin selected cells werepropagated and used for gene expression experiments.
3
Targeted Depletion of CD26 and CD9 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To deplete endogenous CD26 mRNA, three small interfering (si) RNAs and two short hairpins (sh) RNAs were obtained from Qiagen (Hilden, Germany) or Sigma-Aldrich (reference sequence: NM_001935). The sequences are as follows.
CD26 siRNA-1:5′-ACACTCTAACTGATTACTAA-3′ ,
CD26 siRNA-2:5′-CAGTAAAGAGGCGAAGTATTA-3′ CD26 siRNA-3: 5′-ATCGGGAAGTGGCGTGTTCAA-3′ CD26 shRNA-1: 5′-CCGGGACTGAAGTTATACTCCTTAACTCGAGTTAAGGAGTATAACTTCAGTCTTTTTG-3′ CD26 shRNA-2: 5′-CCGGCCAATGCAACTTCCATACAAACTCGAGTTTGTATGGAAGTTGCATTGGTTTTTG-3′ To deplete endogenous CD9, two siRNAs and two shRNAs were used (reference sequence: NM_001769). The sequences are as follows.
CD9 siRNA-1:5′-CGTGGAACAGTTTATCTCAT-3′ CD9 siRNA-2: 5′-AATTGCCGTGGTCATGATATT-3′ CD9 shRNA-1: 5′-CCGGGCTGTTCGGATTTAACTTCATCTCGAGATGAAGTTAAATCCGAACAGCTTTTTG-3′ CD9 shRNA-2: 5′-CCGGCACAAGGATGAGGTGATTAAGCTCGAGCTTAATCACCTCATCCTTGTGTTTTTG-3′ For controls, negative control siRNA (Qiagen) or non-target shRNA control (Sigma-Aldrich) was used.
CD26 siRNA-1:
CD26 siRNA-2:
CD9 siRNA-1:
4
Lentiviral Knockdown of Paxillin in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviral particles containing shRNAs were generated in HEK293T cells using the Addgene (Cambridge, MA) two-plasmid system (pMD2G, psPAX2) and pLKO.1 vectors containing anti-paxillin shRNA (shPXN) or non-targeting shRNA (shNON; Non-Target shRNA Control, Sigma-Aldrich), according to the manufacturer's protocol. Five clones of shPXN were purchased and screened for knockdown efficiency and the TRCN0000123136 clone was selected for further experiments. The viral supernatants were spun down, concentrated by PEG precipitation (PEG 6000, Sigma-Aldrich), aliquoted and stored at −80°C. HepG2 or SAOS2 cells were seeded on a 24-well plate 24 h before transduction. Virus-containing supernatant was added to the medium, incubated overnight and, after 24 h, replaced with fresh medium containing puromycin. Protein, RNA or DNA content was analyzed at 5 days post transduction unless otherwise stated.
5
DOCK11 Knockdown in HepAD38 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DOCK11-target shRNA and a non-target shRNA control (Sigma-Aldrich, St. Louis, MO, USA) were used for the knockdown of the DOCK11 gene in HepAD38 cells, as previously described, but with slight modifications [10 (link)]. Briefly, shRNA was cloned into a lentivirus-based pLKO.1-puro shRNA expression vector. On Day 0, the lentiviral particle supernatant was added to the cells, and they were incubated overnight at 37 °C. On Day 1, the cells were washed twice with PBS, and medium for puromycin selection was added. From Days 3–6, the culture medium was replaced as appropriate. On Day 6, the cells were collected for RNA and DNA isolation or passaged to an 8-well chamber for hybridization.
6
Lentiviral ALCAM Knockdown in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate cell lines in which ALCAM expression had been stably knocked down, we used the MISSION® RNAi system and lentiviral pLKO-puro vector (Sigma Aldrich, St Louis, MO, USA). The sequences of the shRNAs were as follows: shALCAM1, 5’-CCGGCAGCCATGATAATAGGTCATACTCGAGTATGACCTATTATCATGGCTGTTTTTG-3’ and shALCAM2, 5’-CCGGCTTCGATCTAGCCCGTCATTTCTCGAGAAATGACGGGCTAGATCGAAGTTTTTG-3’ . Non-target shRNA Control (Sigma Aldrich) was used as negative control shRNA. Lentivirus was produced by transfection of the lentiviral vector and the Lentiviral Packaging Mix (Sigma Aldrich) in 293T cells. Daoy and ONS-76 cells were then infected with the lentivirus expressing the shRNAs. Knockdown of ALCAM was confirmed by flow cytometry and qPCR after puromycin selection. Before performing the in vitro and in vivo assays, the 10–15% cells with lower ALCAM expression were sorted from the heterogeneous Daoy cell population in which ALCAM had been knocked down (expressing different levels of the protein) by FACS using PE-conjugated mouse anti-human ALCAM antibody.
7
Lentiviral shRNA Transduction and Selection
8
Lentiviral-Mediated Knockdown of IGF2BP3 and EGFR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The IGF2BP3 and EGFR constructs were generated by subcloning PCR amplified full-length human IGF2BP3 and EGFR cDNA into pEZ-Lv105. Stable knockdown of target genes was achieved by lenti-viral based short-hairpin RNA delivery. Target specific shRNAs were cloned into the lenti-viral vector pLKO.1. Viral particles were packaged in 293FT and used to infect SW480 and HCT116 cell lines. Infected cells were selected by puromycin and expanded to form a stable sub-line. Knockdown efficiency was confirmed at both mRNA and protein levels. A non-target control shRNA purchased from Sigma-Aldrich was used as a negative control. The target sequence of IGF2BP3 was shRNA1 (Forward, 5′- CCGGCGGTGAATGAACTTCAGAATTCTCGAGAATTCTGAAGTTCATTCACCGTTTTTG - 3′; Reverse, 5′- AATTCAAAAACGGTGAATGAACTTCAGAATTCTCGAGAATTCTGAAGTTCATTCACCG-3′); shRNA2 (Forward, 5′- CCGGGCAGGAATTGACGCTGTATAACTCGAGTTATACAGCGTCAATTCCTGCTTTTTG-3′; Reverse, 5′- AATTCAAAAAGCAGGAATTGACGCTGTATAACTCGAGTTATACAGCGTCAATTCCTGCTTTTTG -3′);
9
Knockdown of GADD34 in Macrophages and Monocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Murine macrophage RAW264.7 cells were obtained from RIKEN. RAW264.7 cells were cultured in DMEM (Sigma) supplemented with 10% heat-inactivated FBS (Equitech-Bio Inc., Kerrville, TX, USA). The translation of GADD34 mRNA in RAW264.7 cells was knocked down (shGADD34) as previously described.22 (link) Non-target control shRNA (Sigma) was used as a control (shControl). Human monocytic THP-1 cells were obtained from RIKEN. THP-1 cells were cultured in RPMI-1640 (Sigma) supplemented with 10% heat-inactivated FBS (Hyclone, Logan, UT, USA). THP-1 was transfected with 10 nM siRNA using Lipofectamine RNAiMax (Invitrogen, Waltham, MA, USA) according to the manufacturer's instructions. siRNAs were obtained from Ambion (Waltham, MA, USA). The sequence of siRNA used to knockdown GADD34 is 5′-GGAUCAGCCCGAGGAUGAAA-3′. Non-targeted control siRNA was used as a control. Recombinant experiments were approved by the Committee of Nagoya University Graduate School of Medicine.
10
Stable LMWPTP Knockdown in CRC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using a lentiviral system, stably transfected LMWPTP knockdown cells were generated. In brief, HEK293T cells were transfected with LMWPTP or non-target control shRNA (Sigma-Aldrich, St. Louis, USA) and viral plasmid, generating virus containing medium. CRC cells were incubated with the conditioned medium for 48 hours after which transfected cells were selected using puromycin (2 μg/ml, Sigma-Aldrich, St. Louis, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!