G418 sulfate

FLO5, FLO8 and FLO10 genes were inserted into 106a or 1622b locus of the S. cerevisiae 1308 genome by CRISPR/Cas9 system [27 (link)]. This CRISPR/Cas9 system composed of single plasmid (pCAS) and donor DNA. The pCAS plasmid was constructed as previously described [28 ], and protospacer adjacent motif (PAM) sequences of pCAS plasmid were replaced by the corresponding sequences of 106a (ATACGGTCAGGGTAGCGCCC) or 1622b (GTCACGTTCCTGAGGTTACT) locus [27 (link)]. Donor DNA was constructed as follows: the polymerase chain reaction (PCR) was used to amplify terminator (CYC1) from the plasmid of pYES2/CT and other DNA fragments that contained promotor (TPI), upstream homologous sequence, downstream homologous sequence and target genes were obtained from the genome of S. cerevisiae 1308, all DNA fragments were ligated together by overlap PCR. Donor DNA and pCAS plasmid were transformed into S. cerevisiae 1308 according to the previously published electroporation method [27 (link)]. The transformed cells were spread onto the freshly prepared YPD solid medium supplemented with 500 mg/L G418 sulfate (Sangon biotech, China). Following incubation at 30 ℃ for 40 h, recombinant strains were screened by colony PCR with the primers 106a-F/106a-R or 1622b-F/1622b-R. All PCR primers used in this study are listed in Additional file 1: Table S1.

Restriction enzymes, T4 DNA ligase, and DNA polymerase were purchased from Takara Biomedical Technology Co., Ltd. (Beijing, China). EasyPure Plasmid Miniprep Kit was purchased from Tsingke Biotechnology Co., Ltd. (Beijing, China). TIANquick Midi Purification Kit was purchased from Tiangen Biotech Co., Ltd. (Beijing, China). Rapid Yeast Genomic DNA Isolation Kit, yeast powder, peptone, kanamycin, ampicillin, G418 sulfate, and YNB (yeast nitrogen base, without amino acid and ammonium sulfate) were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). GlcNAc was purchased from Aladdin Bio-Chem Technology Co., Ltd. (Shanghai, China). All chemicals used were of analytical grade.

Escherichia coli Trans T1 (Transgen Biotech Co., Ltd, Beijing, China) was used for gene cloning and plasmid amplification. E. coli transformants were selected and cultured in LB medium containing 100 mg/L ampicillin. S. cerevisiae BY4741 strain was used as the host for genome engineering and vindoline production. Yeast strains were routinely cultivated in SCD (5 g/L ammonium sulfate, 1.7 g/L yeast nitrogen base without ammonium and amino acids, 0.6 g/L CSM missing the appropriate nutrients, 20 g/L glucose, and 0.2 g/L methionine) or YPD (10 g/L yeast extract, 20 g/L peptone, and 20 g/L glucose) medium. When necessary, 200 mg/L G418 sulfate (Sangon Bio-tech Co., Ltd, Shanghai, China) was supplemented. All restriction enzymes and T4 DNA ligase were purchased from NEB (Beijing, China). All chemicals were from Sigma-Aldrich (St. Louis, MO, USA) unless specifically mentioned. Tabersonine and vindoline standards were purchased from Chengdu DeSiTe Biological Technology Co., Ltd (Chengdu, China) and Yuanye Bio-tech Co., Ltd (Shanghai, China), respectively.

Plasmids were transfected into HEK293T cells using a DNA transfection reagent (#TF201201, Tengyi Biotech, Shanghai, China). After 48 h, the viral supernatants were collected and used to infect cells with polybrene (#H9268, Sigma-Aldrich, Missouri, MO, America). After two days, puromycin (#A610593-0025, Sangon, Shanghai, China) or G418 sulfate (#A600958-0005, Sangon, Shanghai, China) was used to screen for the desired cell lines.