Minibeadbeater homogenizer

All preparations were performed in the dark and at 4 °C. B. braunii cells were suspended in ice-cold breaking buffer A and supplemented with 1 mM EDTA and a 1× protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO, USA). Cells were disrupted in a 15 mL chamber of a Mini-BeadBeater homogenizer (BioSpec Products, Bartlesville, OK, USA) filled halfway with ice-cold 0.5 mm glass beads for 25 cycles of 15 s beating and 2 min of cooling. Cell debris, intact cells, starch granules, and glass beads settled down as a pellet and were removed by centrifugation at 3000× g at 4 °C for 5 min. The resulting supernatant was collected and centrifuged at 32,600 rpm with a Thermo Scientific AH-650 rotor at 4 °C for 30 min. The pellet of thylakoid membranes was suspended in the supplemented breaking buffer A containing 1% (w/v) n-dodecyl β-d-maltoside (DDM) and solubilized under gentle stirring for 15 min. Subsequently, the solubilized thylakoids were centrifuged at 36,200 rpm with a Thermo Scientific AH-650 rotor at 4 °C for 20 min to obtain stroma membranes as a supernatant; the resulting pellet corresponded to the grana preparation and was discarded. The stromal thylakoid supernatant was stored at −80 °C until use.

Lungs were harvested under sterile conditions, placed in 1 ml PureZOL (Bio-Rad, catalogue number: 732-6890) and mechanically homogenized using 1 mm diameter silica beads (BioSpec Products, United States, catalogue number: 11079110z) in a MiniBeadBeater homogenizer (BioSpec Products) for 2 min. Two hundred (200) μl of the lysate was used to isolate total RNA using the NZY total RNA Isolation kit (NZYTech, catalogue number: MB13402) according to the manufacturer’s instructions. DNAse-treated RNA was reverse transcribed with random hexamers using NZY First-Strand cDNA Synthesis Kit (NZYTech, catalogue number: MB12501). Real-time PCR was performed on ABI 7500 or 7900HT systems (Applied Biosystems), using Universal SYBR Green Supermix (Bio-Rad, catalogue number: 172-5121) and the primers listed below. Relative gene expression was normalized to the geometric mean of the housekeeping gene hypoxanthine guanine phosphoribosyltransferase (Hprt) (ΔCt). Gene expression values were then calculated based on the ΔΔCt method, using the mean of the control group as the calibrator to which all other samples were compared.
Primers used were:
mHprt:
CATTATGCCGAGGATTTGGA; AATCCAGCAGGTCAGCAAAG
Pb18S rRNA:
AAGCATTAAATAAAGCGAATACATCCTTAC; GGAGATTGGT TTTGACGTTTATGTG
mIL-10:
CAGCCGGGAAGACAATAACT; GTTGTCCAGCTGGTCCTTTG

Yeast were grown in 40 mL liquid YPD at 30°C to reach OD₆₀₀ = 1.0. After cross-linking with 1% formaldehyde, cells were lysed using glass beads and ChIP lysis buffer (50 mM HEPES/KOH, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, and 0.1% Na-deoxycholate) in a Mini-Beadbeater Homogenizer (Biospec products). Then cells were sonicated using Diagenode bioruptur (three cycles of 1 minute sonication and 1 minute pause). Immunoprecipitation (IP) was performed using 1 μL of anti-Myc (9E10 sc-40 Santa-Cruz) antibodies and then protein G beads. After cross-linking was reversed, DNA was purified using phenol–chloroform extraction. ChIP and input samples were analyzed by duplex PCR using two sets of primers: ChrV-fwd and ChrV-rev for the normalization in combination with UIRL1 and UIRL2 followed by gel electrophoresis (Table S2, Supplementary Material). The gels were then scanned using the Amersham Typhoon laser scanner with 532 nm laser and Cy3 filter. Intensity of the bands for IP and input samples was measured by NIH ImageJ software. Then IP/input values for the cassette band were normalized to IP/input values for the ChrV fragment. SEM for three or four independent experiments was calculated and the difference between the strains was evaluated with t test.