Iscove s modified dulbecco s medium

SK-MEL-2 cells containing the Luc gene (JCRB cell bank) were maintained at 37 °C in a humidified 5% CO₂ incubator using RPMI1640 culture medium (FUJIFILM Wako Pure Chemical) containing 10% heat-inactivated fetal calf serum (Sigma–Aldrich), 100 U/ml penicillin, and 100 μl/ml streptomycin (Nacalai Tesque) in 10 cm dish (Thermo Fisher Scientific). Dulbecco’s modified Eagle’s medium (FUJIFILM Wako Pure Chemical) or Iscove’s modified Dulbecco’s medium (Nacalai Tesque) was used to maintain A549 or HAP1 cells as previously described (16 (link), 25 (link)). Zinc-supplementation experiments involved adding the indicated concentrations of ZnSO₄ (Nacalai Tesque) to the cell culture medium.

To investigate the association between FUS-ERG and Aza sensitivity, we established haematopoietic cells stably expressing FUS-ERG (Additional file 1; Figure S1). Ba/F3 cells were authenticated using short tandem repeat analysis by the American Type Culture Collection (Manassas, VA, USA) and grown in Iscove's modified Dulbecco's medium (Nacalai, Kyoto, Japan) supplemented with 20% foetal bovine serum, 20% WEHI supernatant, and 1% penicillin/streptomycin in a humidified atmosphere containing 5% carbon dioxide at 37 °C. WEHI cells were cultured in high-glucose-containing Dulbecco's modified eagle medium (Nacalai) supplemented with 10% foetal bovine serum, 5 × 10^–5 M β-mercaptoethanol, and 1% penicillin/streptomycin. The supernatant was collected after centrifugation and 0.22 µm filtration for cytokine supplementation. The full length of FUS-ERG was amplified from the cDNA of the patient sample using the primers GGTACTCAGCGGTGTTGGAA and CTTCCCCAGCCCCAGTAAAG and constructed into pcDNA3.1. cDNA was synthesised from the total RNA using SuperScript III Reverse Transcriptase (Invitrogen, Waltham, MA, USA). Total RNA was isolated using an RNeasy Mini Kit (Qiagen, Hilden, Germany). FUS-ERG-transduced Ba/F3 cells were established using Nucleofector by Amaxa (Lonza, Basel, Switzerland) and selected with 1 mg/ml G418 (Nacalai).