Real-time PCR was performed with QuantiTect SYBR green RT-PCR kits (QIAGEN), using pre-designed QuantiTect Primers (Lag3, QT00113197; Tigit, QT02372314; Pdcd1, QT00111111; Havcr2, QT00120652; Il10, QT00106169; Il21, QT00160678; Maf, QT01063846; Nfil3, QT00265104; Foxp3, QT00138369; B2m, QT01149547 as constitutive control), using an Opticon 2 Real Time Cycler (Bio-Rad). The 2−ΔΔCT method was applied to compare gene expression at the specified stages of EDI versus the PBS-treated control, with or without in vivo peptide challenge as indicated.
Opticon 2 real time cycler
Manufactured by Bio-Rad
The Opticon 2 Real Time Cycler is a compact, high-performance thermal cycler designed for real-time PCR analysis. It features a 96-well sample block, peltier-based temperature control, and a filtered optical detection system. The Opticon 2 facilitates quantitative, qualitative, and multiplexed PCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using opticon 2 real time cycler
1
Quantification of Immune Checkpoint Genes
2
Quantitative PCR Analysis of MDR1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using Trizol (LifeTechnologies, Grand Island, NY) and subjected to reverse transcription with the ReverTra Ace-a-kit (Toyobo, Osaka, Japan) according to the manufacturer's instructions. Real-time PCR was performed on an Opticon 2 Real Time Cycler (BioRad, Hercules, CA) with SYBR Green PCR Master Mix kit (Toyobo, Osaka, Japan). PCR conditions consisted of a 30 second hot start at 95°C, followed by 40 cycles of 5 seconds at 95°C and 30 seconds at 60°C. The primer sequences for human MDR1 (ABCB1) mRNA were as follows: 5′-GGAAAAGAAACCAACUGUC-3′ (forward) and 5′-GACAGUUGGUUUCUUUUCC-3′ (reverse). The primer sequences for rat MDR1 (MDR1a and MDR1b) mRNA were as follows: 5′-CCCAAGATCCTTTTGTTGGA-3′ (forward) and 5′- CAAGCGGTGAGCTATCACAA -3′ (reverse).
3
qPCR Analysis of Splice Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Embryos were pestle-homogenized in 1.5-ml microfuge tubes in lysis buffer and the standard RNA extraction protocol was completed using the RNeasy kit (Qiagen). RNA was converted to cDNA using iScript (Bio-Rad), and qPCR reactions were run on an Opticon 2 Real-Time Cycler (Bio-Rad). See Table S4 for a list of primers used. Fold difference was determined with the comparative Ct method in Microsoft Excel; Δ(Ct) = (Ct, hypoxia-inducible gene) − (Ct, reference gene); ΔΔCt = Δ(Ct, non-stressed control) − Δ(Ct, hypoxia-exposed). Melting curve analysis was performed after the last amplification round to ensure the presence of a single amplified product.
We used exonic primers designed to amplify the MO-targeted exon, the predicted retained intron (if present), and at least a portion of the next downstream exon for btr01, camk2g2, crtc3, ncam2, inhbb, opn5. The MO-induced abnormal mRNAs with retained introns therefore would not be expected to amplify under the short cycle times optimized for qPCR products <250 bp in size and, furthermore, the introduction of stop codons from intronic sequence would predispose these abnormal products to nonsense-mediated decay. For ttll11, a region downstream of the MO-targeted splice site was amplified.
We used exonic primers designed to amplify the MO-targeted exon, the predicted retained intron (if present), and at least a portion of the next downstream exon for btr01, camk2g2, crtc3, ncam2, inhbb, opn5. The MO-induced abnormal mRNAs with retained introns therefore would not be expected to amplify under the short cycle times optimized for qPCR products <250 bp in size and, furthermore, the introduction of stop codons from intronic sequence would predispose these abnormal products to nonsense-mediated decay. For ttll11, a region downstream of the MO-targeted splice site was amplified.
4
Quantitative Gene Expression Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!