Truseq universal primer

The protein-bound beads were incubated with 50 ng of adaptor-ligated gDNA fragments on a rotator for 1 h at room temperature in 50 μl of wash/bind buffer. Beads were washed three times using the same wash buffer to remove unbound DNA fragments. The HaloTag beads were resuspended in 30 μl of elution buffer and heated to 98 °C for 10 min to denature the protein and release the bound DNA fragments into solution. The supernatant was transferred to a new well, and 25 μl were used in a 50 μl PCR employing the KAPA HiFi HotStart ReadyMixPCR Kit (Roche, Basel, Switzerland) for 10 cycles. PCR primers consisted of the full-length Illumina TruSeq Universal primer (5'–AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT–3') and an Illumina TruSeq Index primer (5'–CAAGCAGAAGACGGCATACGAGAT-NNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT–3'), where NNNNNN represents the 6 bp sequence index used for sample identification. The PCR product was purified and selected using AMPure XP beads (Beckman), as previously described, and resuspended in 20 μl of nuclease-free water. DNA concentrations were determined using a Qubit (Life Technologies, Burlington, Ontario, Canada). Eluted DNA fragments were sequenced on an Illumina NavoSeq. Negative control mock DAP-seq libraries were prepared without the addition of protein to the beads.