Anti β actin antibody a3854

Western blotting was performed as previously described.30 (link),31 (link) In brief, tissues and cells were lysed in RIPA buffer (Beyotime, Haimen, People’s Republic of China), and after centrifugation at 13,000 g for 15 min, the concentration of protein in the supernatant was measured using BCA kit (Pierce, Waltham, MA, USA). Approximately 50 μg protein was resolved by 10% SDS-PAGE and transferred onto PVDF membranes (EMD Millipore, Billerica, MA, USA). Followed by incubating with 5% skim milk at room temperature for 1 h, the membranes were incubated with antibodies at 4°C overnight. The membranes were washed with PBST three times and incubated with indicated HRP-conjugated secondary antibodies at room temperature for 1 h. Finally, the membranes were washed with PBST three times, and the blots were visualized by enhanced chemiluminescence-based method. The anti-FOXO6 polyclonal antibody (Ab487306) and anti-Sirt6 antibody (Ab62739) were purchased from Abcam (Cambridge, UK), and the anti-β-actin antibody (A3854) was purchased from Sigma-Aldrich.

Berberine (14050) and the anti-β-actin antibody (A3854) connected with HRP were purchased from Sigma (St. Louis, USA). Doublecortin (DCX, ab18723), Bcl-2 (ab692) and synaptotagmin-1 (ab13259) antibodies were purchased from Abcam (Cambridge, USA). All miRNA related reagents were purchased from Ribobio Co., Ltd. (Guangzhou, China). The sense strand of miR-34a agomir is UGGCAGUGUCUUAGCUGGUUGU. On the other hand, the sequence of cel-miR-239b-5p (UUUGUACUACACAAAAGUACUG) was used for sense strand of mouse agomir control, as this sequence does not target any genes in mice.