HIV-1 mRNA was extracted from 0.2mL of supernatant from five million cultured rCD4s after 18 h of LRA treatment using the ZR-96 Viral RNA kit (Zymo Research). cDNA synthesis was performed using qScript cDNA Supermix (Quanta Biosciences). Real-time PCR was performed using TaqMan Fast Advanced mastermix (Applied Biosystems) on an ABI Viia 7 Real-Time PCR machine. Primers and probes listed below. Manufacturer’s thermal cycling conditions were used. Molecular standard curve was generated as described above.
Zr 96 viral rna kit
Manufactured by Zymo Research
Sourced in United States
The ZR-96 Viral RNA kit is a laboratory product designed for the isolation and purification of viral RNA from various sample types. It utilizes a simple and efficient spin-column format to capture and concentrate viral RNA, making it suitable for downstream applications such as PCR and sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Direct zol 96 rna kit, by Zymo Research (6 mentions)
Tri reagent, by Thermo Fisher Scientific (4 mentions)
Quantifast sybr green pcr kit, by Qiagen (3 mentions)
Goscript reverse transcription system, by Promega (3 mentions)
Impromii reverse transcriptase system, by Promega (3 mentions)
Dnase, by Thermo Fisher Scientific (3 mentions)
Viia7 real time pcr machine, by Thermo Fisher Scientific (2 mentions)
Qscript cdna supermix, by Quanta Biosciences (2 mentions)
Taqman fast advanced master mix, by Thermo Fisher Scientific (2 mentions)
Oligo dt 15 primer, by Promega (2 mentions)
Ion torrent, by Thermo Fisher Scientific (2 mentions)
Miseq platform, by Illumina (2 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Improm 2 reverse transcriptase, by Promega (2 mentions)
Superscript 3 one step rt pcr system, by Thermo Fisher Scientific (1 mentions)
454 gs flx, by Illumina (1 mentions)
Hiseq sequencing, by Illumina (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Taqman rna to ct one step rt pcr kit, by Thermo Fisher Scientific (1 mentions)
Qscript cdna supermix kit, by Quanta Biosciences (1 mentions)
20 protocols using zr 96 viral rna kit
1
Quantifying HIV-1 mRNA Expression
2
Quantification of HIV-1 Polyadenylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purified resting CD4+ T cells (5 × 106) were treated with bromosporine or SAHA in the presence of 10 μM T20 and collected for RNA purification after 18h. ZR-96 Viral RNA Kit (Zymo Research) was used for extraction of total RNA. cDNA synthesis was performed by the GoScript Reverse Transcription System which contained an oligo(dT)15 primer (Promega). According to the methods reported previously [26 (link)], real-time PCR was performed in triplicate using QuantiFast SYBR Green PCR Kit (QIAGEN) on a Roche LightCycler 480 II thermocycler. Primers specific for the HIV-1 3’ polyadenylation (poly A) region were designed as described [26 (link), 51 (link), 52 (link)]: forward (5’ CAGATGCTGCATATAAGCAGCTG - 3’) (9501–9523), reverse (5’ TTTTTTTTTTTTTTTTTTTTTTTTGAAGCAC-3’) (9629 - poly A). Results of each drug treatment from the triplicate samples were averaged and presented as fold change relative to DMSO control.
3
Sequencing Influenza B Virus Genomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We sequenced the complete genomes of 908 laboratxory confirmed influenza B virus MDCK
or MDCK-SIAT cell propagated isolates passaged 1–4 times from eastern
Australia and New Zealand using a novel methodology (Zhou et al., 2014 (link)). Influenza B virus genomes were amplified
using the universal influenza B genomic amplification strategy that enables
amplification of the complete genome of any influenza B virus in a one-step single
tube/well reaction. Specifically, RNA was isolated from 130 μl of culture
supernatant using ZR-96 Viral RNA Kit (Zymo Research, Irvine, CA) and eluted in 30
μl of RNase-free water. 3 μl of the RNA was mixed with FluB Universal
Primer Cocktail (Zhou et al., 2014 (link)) and
converted to cDNA and amplified with the SuperScript III One-Step RT-PCR System (Life
Technologies, Grand Island, NY). The amplicons were fragmented, flanked by sequencing
adaptors, clonally amplified onto IonSphere particles, and sequenced on the Ion
Torrent PGM platform following manufacturer's instruction. The sequence reads
were sorted by bar code to separate different viruses and used to assemble viral
genomes (sequence accession numbers are available in the Dryad data repository under
DOI:10.5061/dryad.n940b ).
or MDCK-SIAT cell propagated isolates passaged 1–4 times from eastern
Australia and New Zealand using a novel methodology (Zhou et al., 2014 (link)). Influenza B virus genomes were amplified
using the universal influenza B genomic amplification strategy that enables
amplification of the complete genome of any influenza B virus in a one-step single
tube/well reaction. Specifically, RNA was isolated from 130 μl of culture
supernatant using ZR-96 Viral RNA Kit (Zymo Research, Irvine, CA) and eluted in 30
μl of RNase-free water. 3 μl of the RNA was mixed with FluB Universal
Primer Cocktail (Zhou et al., 2014 (link)) and
converted to cDNA and amplified with the SuperScript III One-Step RT-PCR System (Life
Technologies, Grand Island, NY). The amplicons were fragmented, flanked by sequencing
adaptors, clonally amplified onto IonSphere particles, and sequenced on the Ion
Torrent PGM platform following manufacturer's instruction. The sequence reads
were sorted by bar code to separate different viruses and used to assemble viral
genomes (sequence accession numbers are available in the Dryad data repository under
DOI:
4
Viral RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was first isolated from serum samples using the ZR-96 Viral RNA Kit (Zymo Research, Orange, CA, USA) according to the manufacturer’s protocol. Quantitative reverse transcription PCR (RT-qPCR) was then performed using the TaqMan RNA-Ct 1-step Kit (Applied Biosystems, San Francisco, CA, USA) and previously described primers [21 (link)].
5
Viral RNA Extraction and Full-Length Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was extracted using Trizol Reagent (Invitrogen Corp, Carlsbad, CA, USA) or using the ZR 96 Viral RNA kit (Zymo Research Corporation, Irvine, CA, USA), as previously described [10 (link),13 (link)]. Full-length genomic sequencing was completed as previously described using targeted multisegment reverse transcription-PCR followed by sequencing with 454 GS FLX+ and Illumina HiSeq sequencing technologies [10 (link)].
6
Sequencing Influenza Viruses from Swine
7
Quantification of Enteric Viral RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from stool was isolated using a ZR-96 Viral RNA kit (Zymo Research). Total RNA from tissues or cells was isolated using Tri Reagent (Invitrogen) and a Direct-zol-96 RNA kit (Zymo Research) according to the manufacturer’s protocol. ImPromII reverse transcriptase was used for cDNA synthesis (Promega). qPCR for muAstV, designed to detect all muAstV strains using primers against conserved regions, was performed as described previously 7 (link). A SYBR green qPCR assay was performed for muAstV STL5 as described previously 9 (link). HAstV1 was quantified using primers specific for HAstVs [Mon269 (5′-CAACTCAGGAAACAGGGTGT-3′) and Mon270 (5′-TCAGATGCATTGTCATTGGT-3′)] 39 (link). Predesigned PrimeTime qPCR assays were used to quantify expression of human and mouse genes, with assays used in this study listed in Table 1 . SYBR green qPCR assays were performed with Power SYBR Green PCR master mix (ThermoFisher) using primers listed in Table 2 .
For IFN-λ ELISA, serum or 30–50 mg of small intestinal homogenate were collected and IFN-λ2/IFN-λ3 levels were analyzed by ELISA as described previously (R&D Systems)40 (link).
For IFN-λ ELISA, serum or 30–50 mg of small intestinal homogenate were collected and IFN-λ2/IFN-λ3 levels were analyzed by ELISA as described previously (R&D Systems)40 (link).
8
Quantitative CHIKV RNA Replication Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
50ng of DVG or CHIKV Carib IVT was transfected in 293T cells (seeded the day before in 48-well plates), in triplicate, as described above. 8 hours post transfection, supernatant was removed, and cells were washed 3 times with PBS before adding fresh medium. At 8, 20, 28 and 44 hours post-transfection, 200ul of lysis buffer from ZR 96 viral RNA kit (Zymo) was added on the cells after supernatant removal and stored at -20°C until all time points were collected. Cellular RNA was extracted with the ZR 96 viral RNA kit and eluted in 15 μl.
TaqMan RNA-to-Ct One-step RT-PCR kit (Applied Biosystems) was used to perform a quantitative RT-PCR spanning the 5’UTR-nsP1 region, with 5’-GAGACACACGTAGCCTACCA-3’ as the forward primer, 5’-GGTTCCACCTCAAACATGGG-3’ as the reverse, and 5’- [6-FAM] ACGCACGTTGCAGGGCCTTCA-3’ as the probe. After 20min at 50°, and 10 min at 95°, 40 cycles were performed (95°C for 15 seconds followed by 60°C for 1 minute).
TaqMan RNA-to-Ct One-step RT-PCR kit (Applied Biosystems) was used to perform a quantitative RT-PCR spanning the 5’UTR-nsP1 region, with 5’-GAGACACACGTAGCCTACCA-3’ as the forward primer, 5’-GGTTCCACCTCAAACATGGG-3’ as the reverse, and 5’- [6-FAM] ACGCACGTTGCAGGGCCTTCA-3’ as the probe. After 20min at 50°, and 10 min at 95°, 40 cycles were performed (95°C for 15 seconds followed by 60°C for 1 minute).
9
Nested PCR for Viral Envelope Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was isolated from 200 µl of the supernatant from each p24+ well using a ZR-96 Viral RNA kit (Zymo Research Corporation). Then, RNA was treated with DNase (Thermo Fisher Scientific) and reverse transcribed using the qScript cDNA Supermix kit (Quanta Biosciences). Because the cultures were seeded at limiting dilution for viral outgrowth, we ran a nested PCR on undiluted cDNA from each well. A nested PCR for the V3-V4 region of env was performed using 600 ng cDNA and primers ES7 (5′-CTGTTAAATGGCAGTCTAGC-3′) and ES8 (5′-CACTTCTCCAATTGTCCCTCA-3′) for the outer reaction. The outer PCR products were diluted 1:50, and 5 µl of this dilution was used for the inner PCR reaction with primers Nesty8 (5′-CATACATTGCTTTTCCTACT-3′) and DLoop (5′-GTCTAGCAGAAGAAGAGG-3′). Primers were obtained from Integrated DNA Technologies. Amplification conditions were as follows: denaturation at 94°C for 3 min, followed by 40 cycles of denaturation at 94°C for 30 s; annealing at 55°C for 30 s; and extension at 68°C for 5 min. PCR products were run on a 1% agarose gel, and bands were extracted using the QIAquick Gel Extraction kit (QIAGEN). Extracted DNA was analyzed directly by Sanger sequencing at Genewiz, Inc.
10
Quantification of HIV-1 Polyadenylation Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purified resting CD4+ T cells (5 × 106) were treated with SAHA or OTX015 for 18 h in the presence of 10 μM T20 and collected for RNA purification. Total RNA was extracted using the ZR-96 Viral RNA Kit (Zymo Research). cDNA synthesis was performed using the GoScript Reverse Transcription System containing an oligo(dT)15 primer (Promega). Real-time PCR was performed in triplicate using the QuantiFast SYBR Green PCR Kit (QIAGEN) on a Roche LightCycler 480 II machine. Primers and probes specific for the HIV-1 3′ polyadenylation (poly A) region were designed as described37 (link)71 (link): forward (5′-3′) CAGATGCTGCATATAAGCAGCTG (9501–9523), reverse (5′-3′) TTTTTTTTTTTTTTTTTTTTTTTTGAAGCAC (9629-poly A) and probe (5′-3′) FAM-CCTGTACTGGGTCTCTCTGG-MGB (9531–9550). Results from the triplicate samples for each drug treatment were averaged and presented as fold change relative to DMSO control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!