Human recombinant bmp2

Highly purified ovine LH (NIADDK oLH-S-16) was obtained from the National Hormone and Pituitary Program (NHPP), Torrance, CA, USA. Recombinant human (rh) BMP2, BMP4, BMP6, BMP7, TNFα, TGFα and EGF were purchased from R&D systems (Abingdon, UK). Highly purified bovine inhibin A and pro-αC were prepared ‘in house’ from pooled bovine follicular fluid (see below). Treatment solutions were sterilized using 0.2 µm membrane filters before dilution in sterile culture medium to required concentrations. For experiments involving knockdown of endogenous INHA and INSL3, siRNA duplexes against bovine INHA (sense strand: GGGAACUUGUCCUGGCCAAUU; antisense strand: UUGGCCAGGACAAGUUCCCUU) and bovine INSL3 (Sense strand: GGCAAGACCUGCUGACCCUUU; antisense strand: AGGGUCAGCAGGUCUUGCCUU) were custom-designed and synthesized by Dharmacon Thermo Scientific (Lafayette, CO, USA). Controls included cells transfected with a non-silencing control RNAi (NSC3; Dharmacon) as well as cells exposed to transfection reagent only (DharmaFECT 2; Dharmacon). All cell culture experiments were repeated using TC prepared from n = 4 independent batches of follicles.

The mouse myoblast cell line, C2C12 [18 (link)], was obtained from the RIKEN Cell Bank (Tsukuba Science City, Ibaraki, Japan). The cells were plated on a 96-well plate at a density of 1.0 × 10⁴ cells/well and were cultured with the standard medium consisted of alpha Minimum Essential Medium (αMEM; Thermo Fisher Scientific, Waltham, MA, USA) containing 10% fetal bovine serum (FBS), 50 U/mL Penicillin and 50 μg/mL Streptomycin (Thermo Fisher Scientific, Waltham, MA, USA) in a humidified 5% CO₂ atmosphere for 24 h at 37 °C. The medium was changed to a growth medium supplemented with 0, 2.5, 5, 10, 20, or 40 μM MDZ (Merck, Darmstadt, Germany) with 125, 250, or 500 ng/mL recombinant human (rh)BMP-2 (#355-BEC, R&D Systems, Minneapolis, MN, USA) with or without 50 nM LDN-193189 (Tocris Bioscience, Bristol, UK). The ALP activity measurement process in each well was described previously [19 (link)]. After 72 additional hours of incubation, the cells were washed once with phosphate-buffered saline (PBS), and ALP activity was assayed using 10 mM p-nitrophenylphosphate as the substrate in a 100 mM 2-amino-2-methyl-1,3-propanediol-HCl buffer (pH 10.0) containing 5 mM MgCl₂ and incubated for 10 min at 37 °C. We added 0.2 M NaOH to quench the reaction, and the absorbance at 405 nm was read on a plate reader.

Human AF cells were isolated enzymatically and cultivated in cultivation medium containing 10% fetal bovine serum (FBS) up to passage 3. Then, cells were seeded in 6-well plates, 350,000 cells in each well. Cells were allowed to adhere for 24 h. Then, the medium was changed and cells were starved for 3 h in a minimal medium (same as cultivation medium, but with 0.5% FBS). Afterwards, one of the following stimulants was added to the medium: human recombinant BMP2 (5 nM) [41 (link)] (R&D Systems, Minneapolis, MN, USA), human recombinant TGFβ1 (200 pM) [42 (link)] (Peprotech, Hamburg, Germany), or TNFα (10 ng/mL) [43 (link)] (Peprotech, Hamburg, Germany). Before induction and after 24 h, cells were lysed using Qiagen lysis buffer (Qiagen, Hilden, Germany) supplemented with β-mercaptoethanol (Roth, Karlsruhe, Germany). Lysed samples were stored at −80 °C until isolation. Isolation of mRNA was accomplished using the Qiagen RNeasy Mini Kit (Qiagen, Hilden, Germany) according to manufacturer’s protocol.