Total RNA from control and exp RNAi embryos at stages 11 to 16 was used to synthesise complementary cDNA by random hexamer priming (RevertAid H Minus First Strand cDNA Synthesis FERMENTAS Kit). A LightCycler 480 Real-Time PCR System and the SYBR Green PCR Master Mix (Roche) were used to amplify cDNAs. CG13167, a mitochondrial ATPase with stable expression, was used to normalise relative quantities. Samples were analysed using the LightCycler 480 Real-Time PCR System software (Roche) (see S1 Text for details).
Lightcycler 480 real time pcr system
Manufactured by Roche
Sourced in Switzerland, Germany, United States, China, Japan, United Kingdom, France, Spain, Canada, Ireland
The LightCycler 480 Real-Time PCR System is a high-performance instrument for real-time PCR amplification and detection. It provides precise quantification of nucleic acid targets across a wide dynamic range.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (365 mentions)
Trizol, by Thermo Fisher Scientific (111 mentions)
Primescript rt reagent kit, by Takara Bio (98 mentions)
Rneasy mini kit, by Qiagen (86 mentions)
Lightcycler 480 sybr green 1 master, by Roche (74 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (64 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (61 mentions)
Lightcycler 480 sybr green 1 master mix, by Roche (48 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (43 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (40 mentions)
Sybr premix ex taq, by Takara Bio (39 mentions)
M mlv reverse transcriptase, by Promega (30 mentions)
Trizol reagent, by Takara Bio (30 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (30 mentions)
Rneasy kit, by Qiagen (29 mentions)
Primescript rt master mix, by Takara Bio (28 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (27 mentions)
Miscript sybr green pcr kit, by Qiagen (27 mentions)
Sybr premix ex taq 2, by Takara Bio (25 mentions)
Quantitect reverse transcription kit, by Qiagen (25 mentions)
1 716 protocols using lightcycler 480 real time pcr system
1
Quantitative Real-Time PCR Analysis
2
miRNA and mRNA Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used the TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scienti c) to synthesize the complementary DNA from miRNA according to the manufacturer's protocol. TaqMan Universal PCR Master Mix, No AmpErase UNG (Thermo Fisher Scienti c), and a LightCycler 480 Real-Time PCR system (Roche Diagnostics, Mannheim, Germany) was used to quantify miRNA, and RNU6B was used as the endogenous control. Relative expression was quanti ed with the 2 -ΔΔCt method.
Quantitative real-time PCR analysis of messenger RNA A High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scienti c) was used to synthesize the complementary DNA from mRNA according to the manufacturer's protocol. qRT-PCR was ampli ed using oligonucleotide primers and the LightCycler 480 Real-Time PCR system (Roche). The ampli cation products were detected using the THUNDERBIRD SYBR qPCR Mix (TOYOBO, Osaka, Japan), and the level of target gene expression was calculated. The expression of the target gene was normalized to endogenous GAPDH expression. Relative expression was quanti ed by the 2 -ΔΔCt method. The PCR primers are listed in Table S1.
Quantitative real-time PCR analysis of messenger RNA A High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scienti c) was used to synthesize the complementary DNA from mRNA according to the manufacturer's protocol. qRT-PCR was ampli ed using oligonucleotide primers and the LightCycler 480 Real-Time PCR system (Roche). The ampli cation products were detected using the THUNDERBIRD SYBR qPCR Mix (TOYOBO, Osaka, Japan), and the level of target gene expression was calculated. The expression of the target gene was normalized to endogenous GAPDH expression. Relative expression was quanti ed by the 2 -ΔΔCt method. The PCR primers are listed in Table S1.
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR (qRT-PCR) was performed by using a Roche LightCycler® 480 Real-Time PCR System. The qRT-PCR amplification protocol was conducted according to the user guide of the SYBR® Green master mixes on the Roche LightCycler® 480 Real-Time PCR System. All samples were tested in triplicate. The data were obtained from 3 independent experiments. The primer sequences are listed in Table 4 .
4
Quantitative Gene Expression Analysis of SARS-CoV-2 Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction and quantitative reverse-transcription PCR (qRT-PCR) were performed as we previously described.42 (link),43 (link) Infected intestinal tissues were collected and homogenized in RLT buffer (Qiagen) and extracted with the RNeasy Mini kit (Qiagen). To quantify the expression level of interferon and cytokine/chemokine markers, qRT-PCR was performed using the QuantiNova SYBR Green RT-PCR kit (Qiagen) with LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland). Each 20-μL reaction consists of 0.2μl of QuantiNova SYBR Green RT-Mix, 1.6-μL each of 10 μM gene-specific forward and reverse primer, 4 μL of extracted RNA as template, 10-μL of 2× QuantiNova SYBR Green RT-PCR Master Mix, and 2.6 μL of RNase-free water. Reactions were incubated at 45°C for 10 minutes for reverse transcription and at 95°C for 5 minutes for denaturation, followed by 45 cycles of 95°C for 5 seconds and 55°C for 30 seconds. The final cooling step of cycling profile is set at 40°C for 30 seconds. The primer sequences are available upon requests. SARS-CoV-2 and SARS-CoV gene copy was quantified using the QuantiNova Probe RT-PCR Kit (Qiagen) with the LightCycler 480 Real-Time PCR System (Roche). The primer and probe sequences were previously described.19 (link)
5
Quantification of ZNF689 and miR-339 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells or tissues using E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek, Norcross, GA, USA) according to the manufacturer’s protocol. cDNA was synthesized using the Transcriptor First Strand cDNA Synthesis Kit. Next, ZNF689 cDNA was quantified with the Lightcycler 480 real-time PCR system (Roche) using SYBR Green I Master Mix (Roche). The reverse transcription of miRNA was performed with the Prime-Script miRNA cDNA Synthesis Kit (TaKaRa), and the miR-339 cDNA was detected on the Lightcycler 480 real-time PCR system (Roche) using the TaqMan MicroRNA Assay Kit (ABI, Foster City, CA, USA). GAPDH and U6 were used as the endogenous control for normalizing ZNF689 and miR-339, respectively. All primers used in this study are shown in Table S1 . The sequences of miR-339 and U6 were quoted from Shen et al.24 (link) Also, the sequences of ZNF689 and GAPDH were designed by ourselves using PubMed.
6
Brachypodium distachyon Extensin and FLA Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to characterise the level of transcript accumulation of the selected genes, RT-qPCR was performed using a LightCycler® 480 SYBR Green I Master in a LightCycler® 480 Real-Time PCR System (Roche, Basel, Switzerland). The total RNA was isolated from the leaves of B. distachyon. The primers used in this research are shown in Table A1 . The genes encoding extensins with their division into classes were as previously described [19 (link)]. The FLA genes were selected based on the annotation found in the Phytozome database (https://phytozome.jgi.doe.gov/pz/portal.html ). The detailed procedure for RT-qPCR was as in Betekhtin, et al. [72 (link)]. Briefly, the isolated RNA were treated with the DNase (QIAGEN, Hilden, Germany), and subsequently used for first-strand cDNA generation. Samples were run in the LightCycler® 480 Real-Time PCR System (Roche, Basel, Switzerland). The PCR conditions were as follow: 5 min at 95 °C, 45 cycles of 10 s at 95 °C, 20 s at 60 °C and 10 s at 72 °C with signal acquisition. Ubiquitin was used as the reference gene and analysis was performed using the 2−∆∆CT method. The significant differences between the samples and control were calculated using the Student’s t-test.
7
Quantification of mRNA Levels by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA quantification by real-time quantitative polymerase chain reaction (qPCR) was performed as previously described [14 (link)]. In brief, RNA was isolated from hippocampus and cortex samples using Qiagen-RNeasy plus universal kit (Qiagen) and reverse-transcribed into cDNA with QuantiTect reverse transcription Kit (Qiagen) according to the manufacturer’s instructions. cDNA of each sample was amplified by real-time Lightcycler 480 PCR System (Roche). RT-PCR for the detection of cyclophilin A (PPIA), myosin light chain kinase (MLCK) and myosin light chain (MLC), interleukin 1β (IL-1β), tumor necrosis factor α (TNFα), interleukin 6 (IL-6), zonula occludens-1 (ZO-1), Claudin 5 (Cl5), and occludin (Ocln) was carried out as previously reported using the real-time Lightcycler 480 PCR System (Roche) [7 (link)]. Equal amounts of cDNA (1 μl) were used in duplicates and amplified with Roche Lightcycler® 480 Probes Master (PPIA, IL-1β, Ocln), 480 SYBR Green I Master (TNFα, IL-6) or Thermo Scientific Absolute Blue SYBR Green (MLCK, MLC, ZO-1, Cl5). The absolute copy numbers of the target genes were normalized against the absolute copy numbers of PPIA as control gene.
8
Quantifying CRAT mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified and cDNA was synthesized as previously described [9] (link). qPCR was performed on The LightCycler® 480 Real-Time PCR system (Roche) using commercially available SYBR Green Jumpstart Taq Ready Mix (Sigma) according to the manufacturer's instructions. The following conditions were used: 2 min at 95 °C (hot start), 40 cycles of 15 s at 95 °C, 45 s at 60 °C, and 45 s at 72 °C. The CRAT expression was normalized against the expression of the housekeeping gene TBP. The following primers were used: CRAT fwd: 5′-GACACAGTCAGCAACTTCAGC, CRAT rev: 5′ GCTGCACAAAGATCTGATCCG; TBP fwd: 5′-GCCCGAAACGCCGAATAT, TBP rev: 5′CCTCATGATTACCGCAGCAAA.
9
Quantitative RT-PCR Analysis of Testis Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One μg of total RNA from adult testes was isolated using TRIzol reagent (Invitrogen), converted to cDNA using SuperScriptII reverse transcriptase (Invitrogen), and then used for quantitative RT-PCR with SYBR Green reagent (Applied Biosystems). Primers were designed from mRNA sequence to detect shv and normalized gapdh transcripts (shv: F- CCATGGAGATCAAGCACCTT, R-TTTCTTGAGCGCTTCCTTGT; GAPDH: F-TGGTACGACAACGAGTTTGGC, R-GTCTCACCCCATTCTACCGC; crq: F- TTCTCATCACCGGCATCACG, R-GCTATCACAAACTGCAAGACG). Thermocycling was conducted in The Light Cycler 480 Real-Time PCR system (Roche). The Light Cycler Analysis Software 4.05. (Roche) was used to analyze amplification plots. The relative quantity of amplified cDNA corresponding to each gene was calculated by using the ΔΔCt method and normalized for expression of gapdh in each sample.
10
Quantitative RT-PCR Analysis of Osteogenic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 5
Quantitative Real Time PCR (Q-PCR)
Cells were homogenized using 1 ml of TRIzol reagent (Invitrogen, Carlsbad, Calif., USA), and total RNA was extracted according to the manufacturer's protocol. cDNA was synthesized using RevertAid™ First Strand cDNA synthesis kit (#K1621 Fermentas, Canada) from 1 μg of total RNA. Quantitative real time PCR amplifications were performed in The LightCycler® 480 Real-Time PCR System (Roche Diagnostics, USA) using LightCycler SYBR Green (Roche Diagnostics, USA) according to the manufacturer's instruction. The sequences of primer sets for Smurf1, Smurf2, RunX2, BMP-2, alkaline phosphatase (ALP), osteocalcin (OCN), Collagen I (Coll) and GAPDH mRNAs, target sites on mRNAs and product sizes by PCR are shown in
Results: WFA at 10 nM treatment of MCOs increased expression of osteogenic genes.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!