DNA extraction from the gastrointestinal contents was performed using glass beads and phenol as described previously [23 (link)]. The mixture of glass beads and phenol was vortexed vigorously using a MicroSmash™ MS-100R system (Tomy Digital Biology, Tokyo, Japan) at 5000 rpm for 30 s. For detection and quantification of microbial number, qPCR analysis was carried out using 10-fold serially diluted extracted or standard DNA (kindly provided by Yakult Central Institute, Kunitachi, Japan) with group- and subgroup-specific primer sets in the KOD SYBR qPCR Mix (TOYOBO, Osaka, Japan) [23 (link)]. For detection of cytokine mRNA, total RNA from murine gastric mucosal tissue was extracted using RNeasy Mini Kits (QIAGEN, Valencia, CA, USA), according to the manufacturer’s protocols. cDNA was synthesized from gastric mucosal cells using the ReverTra Ace® qPCR RT Kit (TOYOBO, Co., Ltd., Osaka, Japan) according to the manufacturer’s protocol. qRT-PCR was carried out using the KOD SYBR qPCR Mix (TOYOBO, Osaka, Japan) with specific primer sets (Table S3 ). And the products were detected on the AriaMx Real-Time PCR System (version 1.61, Agilent Technologies, Foster City, CA, USA). Relative changes in gene expression levels were calculated using the ΔΔCt method. 18S rRNA gene expression level was used for the normalization.
Kod sybr qpcr mix
Manufactured by Toyobo
Sourced in Japan, United States, Germany, Switzerland, China
KOD SYBR qPCR Mix is a reagent for quantitative real-time PCR (qPCR) analysis. It is designed for sensitive and accurate quantification of DNA targets using the SYBR Green detection method.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (39 mentions)
Revertra ace qpcr rt master mix, by Toyobo (33 mentions)
Revertra ace qpcr rt master mix with gdna remover, by Toyobo (27 mentions)
Revertra ace qpcr rt kit, by Toyobo (14 mentions)
Primescript rt reagent kit, by Takara Bio (13 mentions)
Rneasy mini kit, by Qiagen (11 mentions)
Trizol, by Thermo Fisher Scientific (11 mentions)
Lightcycler 480 2 system, by Roche (10 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (9 mentions)
Rneasy protect mini kit, by Qiagen (9 mentions)
Gdna remover, by Toyobo (9 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (8 mentions)
Iscript cdna synthesis kit, by Bio-Rad (8 mentions)
Revertra ace, by Toyobo (7 mentions)
Rneasy plant mini kit, by Qiagen (7 mentions)
Purezol rna isolation reagent, by Bio-Rad (6 mentions)
Primescript 2 1st strand cdna synthesis kit, by Takara Bio (5 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Isogen 2, by Nippon Gene (5 mentions)
Fastgene rna premium kit, by Nippon Genetics (5 mentions)
227 protocols using kod sybr qpcr mix
1
Gut Microbiome Analysis Protocol
2
Quantifying PPM1D Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from mononuclear cells using TRIzol reagent (Invitrogen) and then reversely transcribed to cDNA using ReverTra Ace qPCR RT Kit (Toyobo). After that, qPCR was performed using KOD SYBR qPCR Mix (Toyobo) to quantify PPM1D expression. The procedures of amplification were carried out as follows: first, 3 minutes at 95 degrees centigrade, 40 cycles of PCR then followed by standard conditions with 15 seconds denaturation at 95 degrees centigrade, next elongation for 1 minute at 61 degrees centigrade. And the result was calculated using 2−ΔΔCt method with GAPDH as an internal reference. The primers were listed as follows: PPM1D forward primer: CAATTGGCCTTGTGCCTACT, reverse primer: TCTTTCGCTGTGAGGTTGTG; GAPDH, forward primer: GAGTCCACTGGCGTCTTCAC, reverse primer: ATCTTGAGGCTGTTGTCATACTTCT.
3
Quantitative Analysis of CrBUD23 and CrTrm112 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using RNAiso Plus for Total RNA kit and DNA synthesis performed using PrimeScript™ Double-Strand cDNA Synthesis Kit (Takara). To quantitatively detect changes of CrBUD23 and CrTrm112 expression in both wild-type and transgenic strains, qRT-PCR was performed with Bio-Rad CFX Connect Optics Module or ABI QuantStudio 6 Flex, and the primers used are listed in Supplementary Table S5 . The standard protocol was applied to CrBUD23 and CrTrm112 expression detection using KOD SYBR qPCR Mix (TOYOBO). PCR conditions were as follows: one step of 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. The actin (Cre13.g603700) gene was used as the reference gene in qRT-PCR detection of CrBUD23 and CrTrm112. Data were analyzed using the 2−ΔΔCT program. Three technical replicates and three biological replicates were done.
4
Quantifying Pollen GCS1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the mature pollen of HTR10mRFP plants and each GCS1_RNAi line. The flowers at anthesis were collected in 1.5 mL tubes to reach around 1 mL of volume. Afterward, approximately 1 mL of acetone was added, considering the maintenance of pollen viability through dehydration, followed by vortexing for 1 min to liberate the pollen. The acetone solution containing pollen grains was transferred to a new tube, and then centrifuged at 15,000 rpm for 1 min. After removing the supernatant, the pollen was air-dried and kept at −80 °C until RNA isolation. For each transgenic line, total RNA was isolated from five tubes containing the collected pollen using an ISOSPIN Plant RNA kit (Nippon Gene Co., Ltd., Tokyo, Japan). The first-strand cDNA synthesis from 100 ng of total RNA was performed with a kit ReverTra Ace® qPCR RT Master Mix with gDNA Remover (TOYOBO Co. Ltd., Osaka, Japan) using oligo(dT) primer. Real-time PCR reactions were performed using KOD SYBR qPCR Mix (TOYOBO) and an Applied Biosystems StepOnePlus Real-Time PCR System. The target sequence of GCS1 was amplified with the primers GCS1qRTf and GCS1qRTr (Table S1 ). eIFG4 (At3g60240), as an internal standard, was also amplified with the primers AteIFG4f and AteIFG4r (Table S1 ).
5
Quantification of B. ovata β-tubulin by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify the amount of B. ovata β-tubulin, real-time PCR was performed using KOD SYBR qPCR® Mix (Toyobo, Osaka, Japan) and 40 ng of hemolymph genomic DNA as described in the section 2.8. To make the standard curve, PCR products of B. ovata β-tubulin obtained using a specific primer set (forward primer: 5′-ACACTGTGCATCCTCACCGTCATAT-3′; reverse primer: 5′-CTCGCGGATCTTGCTGATCAGCAGA-3′) described by Sivakumar et al. (2014) (link) were cloned into pGEM-T easy vector (Promega, WI, USA). The plasmids were used as templates at 10-fold serial dilutions. PCR was performed under the following settings: 98°C for 2 min, 40 cycles of denaturation at 98°C for 10 s, annealing at 60°C for 10 s and extension at 68°C for 30 s. All reactions were run in triplicates. The relative abundance of B. ovata DNA and the mean ± standard deviation (SD) were calculated using Microsoft Excel 2010.
6
Quantitative RT-PCR analysis of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized from DNase-treated RNA and amplified using KOD SYBR qPCR Mix (Toyobo) according to the manufacturer’s instructions. mRNA levels were quantified by quantitative RT-PCR using the StepOne Real-Time PCR System (Applied Biosystems). The Actin gene was used as an internal control. Primer sets for each gene amplification were as follows: Actin, 5′-GGTTAAGGCTGGATTTGCTG-3′ and 5′-ATGCATCCTTTTGACCCATC-3′; pAMT, 5′-GTAAGTTCCACTGGTGATCATG-3′ and 5′-TTACTGCTTCTGAGAC-3′; and Pun1, 5′-AGGCATCATCAATGCTAC-3′ and 5′-ATGTTAGTTGCTTCTATGGAG-3′.
7
Real-time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For real-time PCR analyses, total RNA was extracted by Trizol (Invitrogen) from CRC cells and tissue. And cDNA was synthesized using ReverTra Ace qPCR RT Master Mix with gDNA remover (TOYOBO, Japan) following the manufacturer's recommendations. qPCR assays were performed using KOD SYBR® qPCR Mix (TOYOBO, Janpan) in the LightCycler® 480II System (Roche) following the manufacturer's instructions. Treated samples were normalized to controls with the ΔΔCt formula using GAPDH as an endogenous control. The primers used in this study can be found in Supplemental Table 2 .
8
ChIP-qPCR and Histone Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP-qPCR was performed with KOD SYBR qPCR Mix (Toyobo) using Light Cycler 96 (Roche). PCR was performed with the following thermocycling conditions: denaturation at 95 °C for 1 min and 40 cycles of denaturation at 95 °C for 10 s and elongation at 60 °C for 30 s. For site-specific DNA damage assay by CRISPR/CAS9, ChIP signals were calculated as ChIP DNA/Input DNA and expressed as fold enrichment relative to the uncut (mESCs expressing guide RNA and nuclease-deficient CAS9).
Gene expression analyses of histone coding genes were performed using a high-throughput gene expression platform based on microfluidic dynamic arrays (BioMark, Fluidigm) as described previously [52 (link)]. Results of RT-qPCR of histone genes by BioMark were visualized as a heatmap using MeV software [53 (link)]. Statistical analysis was performed using Student’s t test.
Gene expression analyses of histone coding genes were performed using a high-throughput gene expression platform based on microfluidic dynamic arrays (BioMark, Fluidigm) as described previously [52 (link)]. Results of RT-qPCR of histone genes by BioMark were visualized as a heatmap using MeV software [53 (link)]. Statistical analysis was performed using Student’s t test.
9
Quantitative PCR Assay for Globin Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from phenyl hydrazine-induced anemic adult spleens (1 to 2 months old) or fetal liver (e14.5) by ISOGEN (Nippon Gene) and converted to cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO). One-fortieth of the reaction mixture was subjected to quantitative PCR amplification using the KOD SYBR qPCR Mix (Toyobo) and thermal Cycler Dice (TaKaRa Bio) with the following parameters: 95°C for 5s and 60°C for 30s, 40 cycles. The PCR primer sets used for human β(γ)- or β(ε)-globin genes amplification were GM-1S2 and BT-3A3 (126-bp amplicon) or BT-1S3 and EP-3A (152-bp), respectively. Primer set common to both β(γ)- and β(ε)-globin genes amplification was BT-4S1 and BT-4A1.
The primer sets used for mouse endogenous gene expression analyses were as follows:
The primer sets used for mouse endogenous gene expression analyses were as follows:
10
Quantification of Bacterial CFUs by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify the colony-forming units (CFUs) of total and pathogenic bacteria, primers for the 16S rRNA gene and specific virulence genes were used (Table S1 ). The qRT-PCR reaction was conducted using the CFX Connect Optics Module (Bio-Rad, USA) and KOD SYBR qPCR Mix (Toyobo, Japan). The PCR mixture (20 μl) consisted of 10 μl of KOD SYBR qPCR Mix, 7 μl of distilled water, 1 μl of 10 μM forward primer, 1 μl of 10 μM reverse primer, and 1 μl of DNA template. Standard curves for quantification were generated using the log-concentration of serial dilutions [16 (link), 17 (link), 26 (link)]. Bacterial loads were calculated by comparing Ct values with the standard curve. The regression coefficients (r2) of all the standard curves were higher than 0.99.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!