Rna bee

Manufactured by Tel-Test

Sourced in United States

RNA-Bee is a laboratory instrument designed for the isolation and purification of RNA from a variety of biological samples. It utilizes a specialized extraction method to efficiently capture and separate RNA molecules from other cellular components.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

RNA-Bee reagent (42 citations) RNA Bee RNA isolation reagent (13 citations) RNA-Bee solution (5 citations) RNA-Bee isolation reagent (3 citations) RNA-Bee isolation kit (3 citations) RNA-Bee RNA Isolation solvent (2 citations) RNA-Bee™ kit (2 citations)

193 protocols using rna bee

RNA Extraction and RT-PCR Analysis of Pms2

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from frozen tissues was extracted using RNA-BEE (Tel-Test, Inc.) according to the manufacturer’s protocol. Total RNA from cell lines was isolated either using the RNeasy mini kit (Qiagen, Cat# 74104) or RNA-BEE (Tel-Test, Inc.).
RT-PCR analysis was performed using one-step RT-PCR kit (Qiagen) or by cDNA synthesis using Quantitech Reverse transcription Qiagen, kit # 205311) according to the manufacturer’s protocol. The primers from exon 11 (5′ ATCAAGTCTAGGGGTCCAGAGACTGC 3′) and exon 14 (5′ TGGAAGCAAACATCTGTCTGACTCG 3′) of Pms2 were used for RT-PCR. The DNA amplified was gel purified (Qiagen) and sequenced. Amplified PCR products were visualized on agarose gel. Band intensity was quantified using the ImageJ software (http://rsbweb.nih.gov/ij/download.html). The primers used for RT-PCR analysis of morpholino-treated human fibroblasts are listed in Supplementary Table 3.

Biswas K., Couillard M., Cavallone L., Burkett S., Stauffer S., Martin B.K., Southon E., Reid S., Plona T.M., Baugher R.N., Mellott S.D., Pike K.M., Albaugh M.E., Maedler-Kron C., Hamel N., Tessarollo L., Marcus V., Foulkes W.D, & Sharan S.K. (2021). A novel mouse model of PMS2 founder mutation that causes mismatch repair defect due to aberrant splicing. Cell Death & Disease, 12(9), 838.

+ Open protocol

+ Expand

Bacterial RNA Extraction and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Approximately 10⁹ bacterial cells, grown in minimal medium supplemented with NRES, were pelleted by centrifugation and resuspended in 100 μl of the growth medium. One ml of RNA-BEE (Tel-Test, Inc., Friendswood, TX), a solution containing phenol and quinidine thiocyanate, was added to the cells. Two hundred microliters of RNase-free chloroform was added, and the mixture was centrifuged at 4°C to separate the organic and aquatic phases. The aquatic phase was removed by pipetting and added to an equal volume of RNase-free isopropanol, and placed at −80°C overnight. The precipitated nucleic acids were pelleted by centrifuging the samples at 21,100 × g for 10 min at 4°C. The nucleic acids were washed with 500 μl of 75% RNase-free ethanol. The dried RNA/DNA pellet was resuspended in 20 to 50 μl of RNase-free H₂O. The nucleic acids were treated with DNase I (New England BioLabs [NEB], Ipswich, MA) as per the manufacturer’s directions and subsequently stored at −80°C overnight. The RNA was washed with 500 μl of 75% RNase-free ethanol and the dried RNA pellet was resuspended in 20 to 50 μl of RNase-free H₂O. The isolated RNA was either used immediately or placed at −80°C until further use.

Butz H.A., Mey A.R., Ciosek A.L., Crofts A.A., Davies B.W, & Payne S.M. (2021). Regulatory Effects of CsrA in Vibrio cholerae. mBio, 12(1), e03380-20.

+ Open protocol

+ Expand

Quantifying Cathepsin K Expression in RAW Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from RAW cells after 48 hours of incubation with or without rRANKL (Peprotech) and MTA using RNA-Bee (Tel-Test, Friends Wood, TX, USA). One microgram of cDNA was reversed transcribed using SuperScriptTM II RT (Invitrogen), 0.1 M DTT (Invitrogen) and 25 mM dNTP (TaKaRa Bio Inc., Otsu, Shiga, Japan). cDNA was amplified using the TaKaRa Ex Taq System (TaKaRa Bio Inc.). Sequences of specific primer sets were as follows: β actin (housekeeping gene): sense 5’-GACGGGGTCACCCACACTGT-3’, anti-sense 5’-AGGAGCAATGATCTTGATCTTC-3’; cathepsin K: sense 5’-CTGAAGATGCTTTCCCATATGTGGG-3’, anti-sense 5’-GCAGGCGTTGTTCTTATTCCGAGC-3’. An optimized protocol of thermal cycling was used: 94°C for 2min, followed by 35 cycles of 98°C for 10s, 50°C for 30s, and 72°C for 60s, and a final extension at 72°C for 7min, using a MJ Research PTC-200 Thermal Cycler (MJ Research inc). PCR products were separated in 1.5% agarose gels and stained with ethidium bromide (Sigma). The results were expressed as a ratio between the optical densitometry of cathepsin K gene expression signal/β-actin gene expression signal, using the NIH image software analyzer.

, & Atlas M.C. (2000). The rise and fall of the medical mediated searcher. Bulletin of the Medical Library Association, 88(1), 26-35.

+ Open protocol

+ Expand

RNA-Seq Analysis of KSHV Infection

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from KSHV and mock infected cells using RNA-Bee (Tel-Test, Inc.). Quality of extracted RNA was verified prior to library preparation on a 2100 Bioanalyzer (Agilent). Strand specific Illumina compatible paired end RNAseq libraries were generated using the ScriptSeq TM v2 RNA-Seq Library Preparation Kit (Epicentre) as per the manufacturer's recommendations. Libraries were sequenced on a HiSeq 2500 system (Illumina). Quality filtered paired end reads were aligned to the human genome (NCBI build 37.2) using the spliced read mapper TopHat2 [139] (link)–[141] (link). Aligned reads were then assembled and assigned to human transcripts using the Cufflinks2 package [141] (link), [142] . Analysis of differential gene expression, hierarchical clustering of samples and principal component analysis was subsequently performed with the Baggerley's statistical test procedure of the CLC Genomics Workbench v6.5.1 software (Qiagen). For enrichment analysis of functional annotation terms, Gene IDs of genes that were significantly up- or downregulated (p-value < = 0.01, minimal twofold regulation) relative to the mock control were submitted to the DAVID online functional annotation tool (http://david.abcc.ncifcrf.gov/).

Günther T., Schreiner S., Dobner T., Tessmer U, & Grundhoff A. (2014). Influence of ND10 Components on Epigenetic Determinants of Early KSHV Latency Establishment. PLoS Pathogens, 10(7), e1004274.

+ Open protocol

+ Expand

Transcriptome Analysis of Drosophila Gonads

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gonads were dissected from 1–3 day old flies raised at 25°C. Ovaries were dissected from virgin females. 3 biological replicates were dissected for each genotype. Total RNA was isolated from all genotypes using RNA-bee (Tel-Test). Contaminating DNA was removed from the RNA using Turbo-DNA-free (Ambion). 200ng of RNA was used to prepare each library using the illumina TruSeq RNA Library Prep kit v2. 100bp paired-end read sequencing was done by the Johns Hopkins Genetic Resources Core Facility. The bam mutant male and female libraries were sequenced in one lane and the Sxl-RNAi, control-RNAi libraries were sequenced in separate lane, therefore having 6 libraries per lane.

Primus S., Pozmanter C., Baxter K, & Van Doren M. (2019). Tudor-domain containing protein 5-like promotes male sexual identity in the Drosophila germline and is repressed in females by Sex lethal. PLoS Genetics, 15(7), e1007617.

+ Open protocol

+ Expand

RT-PCR and qRT-PCR for Gonadal Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

For RT-PCR and qRT-PCR, total RNA was isolated from ovaries and testes using RNA-bee (Tel-Test). Contaminating DNA was removed from the RNA using Turbo-DNA-free (Ambion). RNA was converted to cDNA using Superscript II (Invitrogen). qRT-PCR was done using 2 biological replicates and in technical triplicate, using SYBR green detection. In-situ hybridization was carried out as previously described [62 (link)]. DIG-labelled sense and antisense probes were synthesized by in vitro transcription of PCR product generated from RP98-1M22 BAC (BACPAC Resources Center).

+ Open protocol

+ Expand

Transcriptome Analysis of Mollusks

Check if the same lab product or an alternative is used in the 5 most similar protocols

Each total RNA sample from the gill and mantle was extracted with RNA-Bee™ (Tel-Test, Friendwood, TX, USA) according to the manufacturer's instructions. The RNA pellet was dissolved in 50 μL DEPC-H₂O and treated with the RNA clean-up protocol from the RNAspin Mini RNA isolation kit (GE Health Care, Piscataway, NJ, USA) according to the manufacturer's instructions to eliminate genomic DNA contamination. RNA integrity was verified by 0.8% agarose gel electrophoresis. Extracted RNA samples were stored at −80°C after isolation. First-strand cDNA was synthesized by reverse transcribing 5 μg of the total RNA using 1 μL of Oligo (dT) (0.5 μg μL⁻¹) primer and 1 μL of PowerScript™ Reverse Transcriptase (Clontech) according to the manufacturer's instructions.

Lin C.H., Yeh P.L, & Lee T.H. (2016). Ionic and Amino Acid Regulation in Hard Clam (Meretrix lusoria) in Response to Salinity Challenges. Frontiers in Physiology, 7, 368.

+ Open protocol

+ Expand

Quantifying HCMV US28 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Infected THP-1 cells were harvested, and RNA was isolated using RNA-Bee (Tel-Test, Inc.). 1μg of total RNA was converted to complementary DNA using an iScript cDNA Synthesis Kit (Bio-Rad). PCR reactions were performed for 30 cycles with Taq DNA polymerase using similar conditions to those described above. Primers for US28 PCR are WEM-116 (forward primer) GCTATGTTTGCCAGTTTGTGTTTTATCACGG and WEM-117 (reverse primer) AGGCTCTAGACTAGCCCACGAAGACGTACAGCAGCGG.

Wu S.E, & Miller W.E. (2016). The HCMV US28 vGPCR induces potent Gαq/PLC-β signaling in monocytes leading to increased adhesion to endothelial cells. Virology, 497, 233-243.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using RNA‐Bee (Tel‐Test Inc., Friendswood, TX). cDNA was synthesized using M‐MLV reverse transcriptase (Promega, Fitchburg WI) according to the manufacturer's instructions. Quantitative RT‐PCR was performed using the Quantitect SYBRgreen PCR kit (Qiagen, Venlo, The Netherlands) with an iQ5 PCR cycler (BioRad, Hercules, CA). For used primer sets, all spanning at least one intron, see Table 2. Data were normalized relative to GAPDH expression. Levels of gene expression in differentiation experiments were expressed as fold‐change relative to expression in SaOS‐2 and HDFA cells using the 2^−ΔΔCt method. Basal levels of gene expression at beginning of experiments were expressed as fold‐change relative to expression in positive controls (e.g., SaOS‐2 cells, HDFA cells, human endothelial cells, and human monocytes).

Schoeman M.A., Oostlander A.E., Rooij K.E., Valstar E.R, & Nelissen R.G. (2017). Peri‐prosthetic tissue cells show osteogenic capacity to differentiate into the osteoblastic lineage. Journal of Orthopaedic Research, 35(8), 1732-1742.

+ Open protocol

+ Expand

Quantification of PKD1 mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using RNA-Bee (TEL-TEST, Friendswood,TX) according to the manufacturer’s instructions. 1 μg of RNA was reverse transcribed to cDNA using ImProm-II Reverse Transcription System from Promega. 100 ng cDNA were used as template for the PCR reaction. The primers used for PKD1 were 5′-TTCTCCCACCTCAGGTCATC-3′ and 5′-TGCCAGAGCACATAACGAAG-3′; and for β-actin 5′-CCTCGCCTTTGCCGATCC-3′ and 5′-GGATCTTCATGAGGTAGTCAGTC-3′. The reaction conditions for the PCR were: 30 seconds denaturation at 95 °C, 1 minute annealing at 60 °C and 1 minute extension at 72 °C; for 30 cycles. Resulting PCR mixtures were resolved on a 2% agarose gel.

Döppler H., Panayiotou R., Reid E.M., Maimo W., Bastea L, & Storz P. (2016). The PRKD1 promoter is a target of the KRas-NF-κB pathway in pancreatic cancer. Scientific Reports, 6, 33758.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!