Slide 8 well

Colocalization studies of internalized CNDs with cell organelles, i.e. mitochondria and lysosomes, were carried out for THP-1 derived macrophages and for HeLa cells using Confocal Laser Scanning Microscopy (CLSM) (LSM 510, Zeiss, Germany) with a Plan-Apochromat ×63/1.40 Oil DIC M27 objective. Firstly, THP-1 monocytes were seeded at a density of 75,000 cells per well with complete RPMI 1640 medium volume V_medium = 0.3 mL supplemented with PMA at a concentration of 150 nM in µ-Slide 8 Wells (ibidi GmbH, Germany) with 1 cm² growth area per well. After 72 h incubation time in a cell culture incubator, the THP-1 monocytes had been differentiated into THP-1 derived macrophages. In the case of HeLa cells, 12,000 cells were seeded per µ-Slide 8 Well with the complete DMEM medium of volume V_medium = 0.3 mL per well and were cultured in a cell culture incubator at 37 °C in 5% CO₂ overnight. After this, for both cells type the previous medium was replaced with the V_medium = 0.3 mL CNDs dispersed in RPMI 1640 and DMEM medium supplemented with 10% or 0% FBS at a concentration of C′_CNDs = 400 μg mL^–1 for THP-1 derived macrophages and HeLa cells, respectively. After 24 or 48 h incubation time, mitochondria and lysosome were labeled with corresponding staining reagents as described in the following.

Lipid peroxidation was evaluated with Image-iT^® Lipid peroxidation Kit (Invitrogen, Carlsbad, CA, USA) following manufactures instructions. Briefly, 2 × 10⁴ cells were plated on µ-Slide 8 wells (Ibidi GmbH, Gräfelfing, Germany), and the day after were exposed or not to 10 mM WKYMVm or 10 nM ANXA1 for 3, 6, or 12 h before the incubation for 2 h with 100 mM cumene hydroperoxide to induce lipid peroxidation. Untreated cells were used as a negative control, whereas exposure to cumene hydroperoxide was used as a positive control (PMID: 31901729). Thirty minutes before the conclusion of cell treatments, cells were incubated with 10 mM Image-iT^® Lipid Peroxidation Sensor, which is 581/591 nm C11 reagent and is a sensitive fluorescent report for lipid peroxidation. Nuclei staining was performed by incubating cells with Hoechst 33343 (Invitrogen, Carlsbad, CA, USA). Z-slice images were acquired with a Leica Thunder Imaging System (Leica Microsystems, Wetzlar, Germany) equipped with a LEICA DFC9000 GTC camera, Lumencor fluorescence LED light source, and 63× oil immersion objective. ImageJ software Version 1.53 was used for the quantitative fluorescence ratio analysis of green signals at 527 nm (representing peroxidized lipids)/red signals at 590 nm (representing non-peroxidized lipids).

An A-375 stable cell line expressing mitochondrial single-stranded DNA-binding protein (SSBP1) fused with green fluorescence protein (GFP) (A-375-SSBP1-GFP) was generated. The full coding sequence of SSBP1 was amplified by PCR from cDNA using primers: GTCTCTACGCTGCTTGGTCT and ATTCTTGTCCTTGGAAGCCA. SSBP1 was cloned into lentiviral plasmid with C-terminal GFP and a clone with the highest proportion of GFP-positive signal without limiting cell growth was selected. A-375-SSBP1-GFP cells were plated in µ-Slide 8 Wells (ibidi GmbH, Gräfelfing, Germany) at 10,000 cells per well and left to adhere for 24 h.
Cells were also exposed to 2000 nM salt 1-3C or 5000 nM salt 1-8C for 15 min, 4 h, and 24 h, and cells were imaged using a live cell imaging microscope (60× objective) at 37 °C, 95% humidity, and 5% CO₂ (Nikon, Tokyo, Japan).