Sybr green real time pcr kit

In order to verify the transfection of efficiency and the expression of METTL7A in PIG1, A2058, and SKMEL28, RT-qPCR was used. TRIzol reagent (Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used to extract total RNA from the 6-well plate, for the detection of METTL7A mRNA expression, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was used. In this study, qPCR was conducted on a CFX96 Touch Real-Time PCR system with a SYBR Green Real-Time PCR kit (Thermo Fisher Scientific, Inc.). The primers used for real-time PCR were METTL7A-F: 5′- GTGCAACCTGACCAGAGAGA -3′and METTL7A-R: 5′- GTGCTGCAGCTTCAGCTTAG -3′; GAPDH-F: 5′-CTGGGCTACACTGAGCACC-3′and GAPDH-R: 5′-AAGTGGTCGTTGAGGGCAATG-3′.In this study, qPCR was performed under the following conditions: 95 °C for 30s, followed by 40 cycles of 95 °C for 5 s, 55 °C for 30 s and 72 °C for 30 s. and the 2^−ΔΔCq method was used to calculate changes in gene expression within a target gene.

Cells were seeded at the density described above and incubated for 24 hours before the addition of vemurafenib. The compounds were added to the final concentrations of 0, 20, 40, and 60 μM. After 48 hours of treatment, Cell pellets were collected for experiments. Total RNA was isolated from MCF-7, SK-BR-3 and MDA-MB-231 by using Trizol reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer’s instructions. Total RNA (1 μg) from each group of treated cells was converted to cDNA using a FastKing RT reagent kit (Tiangen, Inc.). The RT reaction was performed at 42°C for 15 min and 95°C for 3 min. qPCR was performed with a SYBR Green Real Time PCR kit (Thermo Fisher Scientific, Inc.) on CFX96 Touch Real Time PCR System (BioRad Laboratories, Inc.) under the following conditions: 95°C for 1 min, then 40 cycles of 95°C for 5 sec and 60°C for 15 sec. The gene expression level was calculated as 2(^−△△Ct) method, and the △Ct means the Ct of target gene minus the Ct of reference gene. The primers used for real-time PCR were BCL2A1 (forward) 5’-AAATTGCCCCGGATGTGGAT-3’ and (reverse) 5’-ACAAAGCCATTTTCCCAGCCT-3’; GAPDH (forward) 5’-CTGGGCTACACTGAGCACC-3’ and (reverse) 5’-AAGTGGTCGTTGAGGGCAATG-3’.

PMN-MDSCs and M-MDSCs in the mouse spleens under the indicated conditions were FACS-sorted on the BD FACSAria. The cells were in vitro cultured in RPMI-1640 (Gibco) supplemented with 10% HI-FBS, 100 U/mL penicillin and 100 μg/mL streptomycin, and then treated with 10 μM NE or 20 μM propranolol (Selleck Chemicals) for 1 h. Total RNAs of the cells were extracted by the RNeasy Mini Kit and analyzed by the SYBR Green Real-Time PCR Kit (Thermo Fisher Scientific). Gapdh mRNA levels were utilized as the internal control.

In accordance with the recommendations provided by the manufacturer, Trizol (Thermo Fisher Scientific, Inc.) was utilized to isolate total RNA from LPS-treated and Sham group DRG specimens, followed by reverse transcription of 1 μg of total RNA into first‐strand cDNA utilizing a PrimeScript RT Reagent kit (Takara Bio, Inc., Otsu, Japan). Subsequently, the SYBR‐Green real‐time PCR kit (Thermo Fisher Scientific, Inc.) was utilized to conduct qPCR with the help of the ABI StepOnePlus Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The internal control for the analysis of circulating RNAs was chosen as GAPDH. In order to prepare the reactions, the following conditions were utilized: 2 μl cDNA, 5 μl RNase-free water, 0.125 μl reverse primer, 0.125 μl forward primer, 0.25 μl ROX Reference dye II, and 7.5 μl SYBR Premixm Ex Taq II. The following were the thermocycling parameters: 30 seconds for one step at 95°C, accompanied by 40 cycles of 95°C for 5 seconds and 60°C for 30 seconds, and the last step at 95°C for 15 seconds, 60°C for 15 seconds, and followed by 95°C for 15 seconds. In this analysis, the 2^−ΔΔcq method was adopted to determine the circRNAs' relative expression level [10 (link)]. Table 1 provides a list of the primer sequences.