DNA was enzymatically extracted from biopsies of gastric mucosa as previously described [18 (link)]. The V1–V2 region of the 16S rRNA was amplified using polymerase chain reaction (PCR) with the forward primer 27Fmod (5′- AATGATACGGCGACCACCGAGATCTACACxxxxxxxxACACTCTTTCCCTACACGACGCTCTTCCGATCTagrgtttgatymtggctcag-3′), containing the Illumina Nextera Adapters sequcence and a unique 8-bp barcode sequence for each sample (Barcode sequence by x), and the reverse primer 338 R (5′-CAAGCAGAAGACGGCATACGAGATxxxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTtgctgcctcccgtaggagt-3′) containing the Illumina Nextera Adapters sequence using a 9700 PCR System (Life Technologies, Tokyo, Japan) as previously reported [19 (link)]. PCR amplicons were purified using AMPure XP magnetic purification beads (Beckman Coulter, Brea, CA, USA) and quantified using the Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies Japan). An equal amount of each PCR amplicon was mixed and subjected to sequencing with MiSeq (Illumina) using MiSeq Reagent Kit v2 (500 cycles) according to the manufacturer’s instructions [20 (link)].
Ampure xp magnetic purification beads
Manufactured by Beckman Coulter
Sourced in United States, Japan
AMPure XP magnetic purification beads are a nucleic acid purification system that utilizes carboxylate-coated paramagnetic beads to selectively bind and purify DNA or RNA from a variety of samples. The beads can be used to size-select or clean up nucleic acid samples prior to downstream applications such as sequencing, PCR, or other molecular biology techniques.
Automatically generated - may contain errors
Lab products found in correlation
Quant it picogreen dsdna assay kit, by Thermo Fisher Scientific (11 mentions)
Ex taq polymerase, by Takara Bio (7 mentions)
454 gs junior, by Roche (7 mentions)
Miseq reagent kit v3, by Illumina (5 mentions)
Achromopeptidase, by Fujifilm (3 mentions)
Veriti thermal cycler, by Thermo Fisher Scientific (3 mentions)
Miseq sequencer, by Illumina (3 mentions)
454 gs flx titanium, by Roche (3 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (2 mentions)
Miseq system, by Illumina (2 mentions)
Lysozyme, by Merck Group (2 mentions)
Kapa hifi hotstart readymix pcr kit, by Nippon Genetics (2 mentions)
Pcr system 9700, by Thermo Fisher Scientific (2 mentions)
Miseq reagent kit v2, by Illumina (1 mentions)
Dntps, by New England Biolabs (1 mentions)
Nucleospin soil kit, by Macherey-Nagel (1 mentions)
Beads crusher μt 12, by TAITEC (1 mentions)
Ion torrent pgm, by Thermo Fisher Scientific (1 mentions)
Picogreen, by Thermo Fisher Scientific (1 mentions)
Kapa hifi hotstart readymix, by Roche (1 mentions)
20 protocols using ampure xp magnetic purification beads
1
Gastric Mucosa 16S rRNA Sequencing
2
Gut Microbiome Analysis in Retinitis Pigmentosa
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We analyzed the feces of 25 RP patients and 27 normal individuals to obtain 16S rRNA metagenomic data. Mean age (years) of the patients was 54.8 ± 2.8 (standard error of the means) and that of normal individuals was 52.8 ± 2.8. The male to female ratios were 7:18 in RP patients and 12:15 in normal individuals. In patients, mean age of disease onset was 44.8 ± 3.4 and mean disease duration (years) was 10.0 ± 1.6. The clinical data of the 25 RP patients were summarized in Table 1 .
We described here the study methods briefly. We extracted genomic DNA from fecal samples by treating them with achromopeptidase (Wako Pure Chemical Industries, Tokyo, Japan) [20 ]. We amplified the V1–V2 16S rRNA gene region by primers according to a procedure reported previously [21 (link)]. We purified (AMPure XP magnetic purification beads, Beckman Coulter, Tokyo, Japan), quantified (Agilent 2100 Bioanalyzer, Agilent Technologies Japan, Tokyo, Japan), and sequenced the amplicon libraries (Ion Torrent PGM, Life Technologies Japan, Tokyo, Japan).
We described here the study methods briefly. We extracted genomic DNA from fecal samples by treating them with achromopeptidase (Wako Pure Chemical Industries, Tokyo, Japan) [20 ]. We amplified the V1–V2 16S rRNA gene region by primers according to a procedure reported previously [21 (link)]. We purified (AMPure XP magnetic purification beads, Beckman Coulter, Tokyo, Japan), quantified (Agilent 2100 Bioanalyzer, Agilent Technologies Japan, Tokyo, Japan), and sequenced the amplicon libraries (Ion Torrent PGM, Life Technologies Japan, Tokyo, Japan).
3
Fecal Bacterial DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To extract fecal bacterial DNA, we used an enzymatic lysis method with lysozyme (Sigma-Aldrich Co., St. Louis, MO) and achromopeptidase (Wako Pure Chemical Industries, Ltd, Osaka, Japan) for all subjects, as described previously13 (link). To amplify the bacterial 16S rRNA gene V3–V4 regions, we used the 16S amplicon PCR forward primer (5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3′) and the 16S amplicon PCR reverse primer (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3′), with adaptor sequences for Illumina indexing. PCRs were run for 25 cycles, using the KAPA HiFi HotStart ReadyMix PCR Kit (Nippon Genetics Co., Ltd, Tokyo, Japan). Amplicons were purified with AMPure® XP magnetic purification beads (Beckman Coulter, Inc., Brea, CA) and quantified with 4200 TapeStation (Agilent Technologies Japan, Ltd., Tokyo, Japan). Equal amounts of amplicons from all the samples were sequenced with the MiSeq System (Illumina, Inc., Tokyo Japan), according to the manufacturer’s instructions13 (link). In the control group, we re-analyzed the 16S rRNA sequence at the V3-V4 region in the same way as for the bowel prep group from preserved DNA samples and did not use any previously obtained data13 (link).
4
Genomic DNA Isolation and 16S rRNA Gene Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from the collected samples using the nexttec™ 1-Step DNA Isolation Kit (nexttec Biotechnologie GmbH, Leverkusen, Germany). PCR was conducted using universal primers (27Fmod and 338R) for 16S rRNA gene sequencing, as previously described6 (link). PCR was performed using Ex Taq polymerase (Takara Bio, Shiga, Japan) and approximately 20 ng of template DNA.
Thermal cycling was performed in a Veriti Thermal Cycler (Life Technologies Japan, Tokyo) with the following cycling conditions: initial denaturation at 96 °C for 2 min, followed by 25 cycles of denaturation at 96 °C for 30 s, annealing at 55 °C for 45 s, extension at 72 °C for 1 min, and final extension at 72 °C. PCR amplicons were purified using AMPure XP magnetic purification beads (Beckman Coulter, Brea, CA, USA) and quantified using the Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies Japan). After quantification, mixed samples were prepared by pooling approximately equal amounts of each amplified DNA and sequenced using MiSeq Reagent Kit V3 (300 × 2 cycles) and a MiSeq sequencer (Illumina, CA, USA), according to the manufacturer’s instructions.
Thermal cycling was performed in a Veriti Thermal Cycler (Life Technologies Japan, Tokyo) with the following cycling conditions: initial denaturation at 96 °C for 2 min, followed by 25 cycles of denaturation at 96 °C for 30 s, annealing at 55 °C for 45 s, extension at 72 °C for 1 min, and final extension at 72 °C. PCR amplicons were purified using AMPure XP magnetic purification beads (Beckman Coulter, Brea, CA, USA) and quantified using the Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies Japan). After quantification, mixed samples were prepared by pooling approximately equal amounts of each amplified DNA and sequenced using MiSeq Reagent Kit V3 (300 × 2 cycles) and a MiSeq sequencer (Illumina, CA, USA), according to the manufacturer’s instructions.
5
16S rRNA Gene Sequencing of Microbial Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from the collected samples using a Nexttec 1-Step DNA Isolation Kit (nexttec Biotechnologie GmbH, Leverkusen, Germany). PCR used universal primers (27Fmod and 338R) for 16S rRNA gene sequencing, as previously described36 (link),37 (link). PCR used Ex Taq polymerase (Takara Bio, Shiga, Japan) and approximately 20 ng of template DNA.
Thermal cycling was performed in a Veriti Thermal Cycler (Life Technologies Japan, Tokyo, Japan). Cycling conditions were: initial denaturation at 96 °C for 2 min, followed by 25 cycles of denaturation at 96 °C for 30 s, annealing at 55 °C for 45 s, extension at 72 °C for 1 min, and final extension at 72 °C. PCR amplicons were purified using AMPure XP magnetic purification beads (Beckman Coulter, CA, USA) and quantified using a Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies Japan). After quantification, mixed samples were prepared by pooling approximately equal amounts of each amplified DNA. Samples were sequenced using a MiSeq Reagent Kit V3 (300 × 2 cycles) and a MiSeq sequencer (Illumina, CA, USA), following the manufacturer's instructions.
Thermal cycling was performed in a Veriti Thermal Cycler (Life Technologies Japan, Tokyo, Japan). Cycling conditions were: initial denaturation at 96 °C for 2 min, followed by 25 cycles of denaturation at 96 °C for 30 s, annealing at 55 °C for 45 s, extension at 72 °C for 1 min, and final extension at 72 °C. PCR amplicons were purified using AMPure XP magnetic purification beads (Beckman Coulter, CA, USA) and quantified using a Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies Japan). After quantification, mixed samples were prepared by pooling approximately equal amounts of each amplified DNA. Samples were sequenced using a MiSeq Reagent Kit V3 (300 × 2 cycles) and a MiSeq sequencer (Illumina, CA, USA), following the manufacturer's instructions.
6
16S rRNA Gene Amplification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The V1/V2 region of the 16S rRNA gene was amplified using a forward primer (5′-CCA TCTCATCCCTGCGTGTCTCCGACTCAGNNNNNNNNNNAGRGTTTGATYMTGGCT CAG-3′) containing 454 primer A, a unique 10-bp barcode sequence for each sample (indicated as N), and 27Fmod (5′-AGR GTTTGATYMTGGCTCAG) in which the third base, A, in the original primer 27F was changed to R, as well as the reverse primer (5′-CCT ATCCCCTGTGTGCCTTGGCAGTCTCAGTGCTGCCTCCCGTAGGAG T-3′) containing 454 primer B and reverse primer 338R (5′-TGC TGCCTCCCGTAGGAGT). Amplified products of ~370 bp were confirmed using agarose gel electrophoresis, purified using AMPure XP magnetic purification beads (Beckman Coulter, Inc., Brea, CA, USA), and quantified using the Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies Japan). Mixed samples were prepared by pooling approximately equal amounts of PCR amplicons from each sample and then subjected to 454 GS Junior (Roche Applied Science, Indianapolis, IN, USA) sequencing following the manufacturer's instructions. The sequencing data were deposited into the Sequence Read Archive (SRA) of NCBI1 and can be accessed via accession number SRP076881 .
7
16S rRNA Gene V1-V2 Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 16S rRNA gene V1-V2 region was amplified by PCR with barcoded 27Fmod (5′-agrgtttgatymtggctcag-3′) and the reverse primer 338R (5′-tgctgcctcccgtaggagt-3′) [15 (link)]. PCR was performed using 50 μl of 1× Ex Taq PCR buffer composed of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, and 1.5 mM MgCl2 in the presence of 250 μM dNTPs, 1 U Ex Taq polymerase (Takara Bio, Kyoto, Japan), forward and reverse primers (0.2 μM), and ~20 ng of template DNA. Thermal cycling was performed in a 9700 PCR System (Life Technologies Japan, Tokyo, Japan) and the cycling conditions were as follows: initial denaturation at 96°C for 2 min, followed by 25 cycles of denaturation at 96°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 1 min, and a final extension at 72°C. PCR amplicons were purified using AMPure XP magnetic purification beads (Beckman Coulter Inc., Brea, CA, USA) and quantified using the Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies Japan). An equal amount of each PCR amplicon was mixed and subjected to sequencing with the 454 GS FLX Titanium or 454 GS JUNIOR platform (Roche Applied Science, Indianapolis, IN, USA), according to the manufacturer’s instructions.
8
Reagents and Kits for Molecular Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All primers were purchased from Integrated DNA Technologies (IDT). Primers containing barcodes (Supplementary Table S2 ) were purchased with an additional HPLC purification. DNA gel extraction kits were purchased from Qiagen (QIAquick Gel Extraction Kit, 28704), Zymo Research (DNA Clean and Concentrator-5, D4013), and AMPure XP magnetic purification beads (A36881) from Beckman Coulter. Reagents for PCR including dNTPs and Phusion High-fidelity polymerase (E261) were purchased from New England Biolabs (NEB). For the Golden Gate Assembly, the following reagents were purchased: Eco31I (ER0292) and T4 DNA ligase (M1801) from Promega; T7 DNA ligase (L602L) from Enzymatics; BsaI (R0535), BsaI-HFv2 (R3733) and Gate Assembly Kit (E1601) from NEB.
9
16S rRNA Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
16S rRNA sequencing was performed using universal primers (27Fmod and 338R) [24 (link), 25 (link)]. Specifically, Ex Taq polymerase (Takara Bio, Shiga, Japan) was used to amplify approximately 20 ng of template DNA with Veriti Thermal Cycler (Life Technologies Japan, Tokyo, Japan) under the following cycling conditions: initial denaturation at 96 °C for 2 min, followed by 25 cycles at 96 °C for 30 s, at 55 °C for 45 s, and at 72 °C for 1 min.
The PCR product was purified with AMPure XP magnetic purification beads (Beckman Coulter, CA, USA) and quantified with Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies Japan). After quantification, mixed samples were prepared by pooling approximately equal amounts of each amplified DNA. Samples were sequenced using a MiSeq Reagent Kit V3 (300 × 2 cycles) and a MiSeq sequencer (Illumina, CA, USA), according to the manufacturer’s instructions.
The PCR product was purified with AMPure XP magnetic purification beads (Beckman Coulter, CA, USA) and quantified with Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies Japan). After quantification, mixed samples were prepared by pooling approximately equal amounts of each amplified DNA. Samples were sequenced using a MiSeq Reagent Kit V3 (300 × 2 cycles) and a MiSeq sequencer (Illumina, CA, USA), according to the manufacturer’s instructions.
10
16S rRNA Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The V1/V2 region of the 16S rRNA gene was amplified using a forward primer (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAGNNNNNNNNNNAGRGTTTGATYMTGGCTCAG-3′) containing 454 primer A, a unique 10-bp barcode sequence for each sample (indicated as N), and 27Fmod (5′-AGRGTTTGATYMTGGCTCAG) in which the third base, A, in the original primer 27F was changed to R, as well as the reverse primer (5′-CCTATCCCCTGTGTGCCTTGGCAGTCTCAGTGCTGCCTCCCGTAGGAGT-3′) containing 454 primer B and reverse primer 338R (5′-TGCTGCCTCCCGTAGGAGT). Amplified products of ~ 370 bp were confirmed using agarose gel electrophoresis, purified using AMPure XP magnetic purification beads (Beckman Coulter, Inc., Brea, CA, USA), and quantified using the Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies Japan). Mixed samples were prepared by pooling approximately equal amounts of PCR amplicons from each sample, and then subjected to 454 GS Junior (Roche Applied Science, Indianapolis, IN, USA) sequencing following the manufacturer’s instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!