Tcs sp2 confocal spectral microscope imaging system

The full‐length coding region of GmEIL1 was fused to sequences encoding the N‐terminus of GFP under the control of the cauliflower mosaic virus 35S promoter (35S) in the pCAMBIA1302 vector using primers GmEIL1‐GF and GmEIL1‐GR (Table S1). The GmEIL1‐GFP and H2B‐mCherry fusion plasmids (or 35S:GFP and the H2B marker (H2B, NM_122194.3) for the nucleus) were cotransformed into Arabidopsis protoplasts using a polyethylene glycol‐mediated method (Yoo et al., 2007 (link)). Localization of the fusion proteins was visualized using a TCS SP2 confocal spectral microscope imaging system (Leica). The transfected protoplasts were incubated in weak light at 22°C for 16–20 h. Protoplasts were collected and lysed to extract total proteins. For localization of GmEIL1‐GFP or GFP, nuclei were isolated using a Protein Isolate Extraction Kit (Sangon Biotech). The supernatants of extracts were separated by SDS‐PAGE. After electrophoresis, the proteins were transferred to polyvinylidene difluoride membranes (Millipore) and probed using anti‐GFP antibodies (Abmart). Signals on immunoblots were quantified using ImageJ software.

For BiFC assays, the GmERF113 gene was cloned into pSAT6-nEYFP-N1 and the full-length coding sequences of GmbHLH, GmPRP, GmHAT5, and GmFAO cDNA were also amplified by PCR and cloned into pSAT6-cEYFP-C1, respectively. These constructs were transiently transfected into Arabidopsis protoplasts using the polyethylene glycol method, as described by Yoo et al. (2007) (link). Transfected cells were imaged using a TCS SP2 confocal spectral microscope imaging system (Leica).

To investigate the subcellular localization of GmPAL2.1, the full-length GmPAL2.1 was cloned in frame into the 5′-terminus of the GFP coding sequence in the 35 S:GFP vector using the primer pairs GmPAL2.1-GF and GmPAL2.1-GR (Supplementary Table 1), generating the fusion construct 35 S:GmPAL2.1-GFP. Arabidopsis protoplasts were acquired using the method described by Lin^{102 (link)}. Arabidopsis protoplast transformation was performed as described by Yoo et al.^{103 (link)} with minor modifications. After incubation of the transfected Arabidopsis protoplasts cells for 16 h at 25 °C, the GFP signal was imaged using a TCS SP2 confocal spectral microscope imaging system (Leica, Germany).

A CsDIR16-GFP (green fluorescent protein) vector was constructed by cloning the CsDIR16 ORF into a pGII-eGFP vector using the primers 5′-AACGGATCCATGGCTGGAATCTCTCCAAT-3′ (HindIII site underlined) and 5′-TCCCCCGGGAATAATGAAGCACGTAAATGTTA-3′ (SmaI site underlined). The plasmids pGII-eGFP and pGII:CsDIR16-eGFP were transformed into Arabidopsis protoplast cells [24 (link)]. Subcellular localization in protoplasts was observed using a TCS SP2 confocal spectral microscope imaging system (Leica, Germany).

The following primers were designed with XmaI and BamHI restriction sites: CsMAPEG-LF, CGGGATCCATGGCCGCAATCCAGCTTCTC; and CsMAPEG-LR, CCCCCCGGGTAATGACGAAGAAGCTTAACACCGAAC. The CsMAPEG open reading frame without a stop codon was amplified. The pEASY-T3-CsMAPEG fusion expression vector and pGII-eGFP transient expression vector were digested by rapid digestion with the endonucleases XmaI and BamHI, and the purified product was recovered by gel electrophoresis and ligated using the T4 ligase to obtain the fusion expression vector 35S-CsMAPEG-eGFP. This construct was transformed into E. coli cells and identified. The empty pGII-EGFP vector was used as a negative control. The 35S-CsMAPEG-eGFP and empty pGII-EGFP vector plasmids were transfected into isolated Arabidopsis protoplasts [39 (link)]. The subcellular localization in protoplasts was observed using a TCS SP2 confocal spectral microscope imaging system (Leica, Germany). GFP fluorescence was observed at an excitation wavelength of 488 nm and an emission wavelength of 530 nm.

For interaction studies, the gene sequences were cloned into serial pSAT6 vectors encoding N- or C-terminal-enhanced yellow fluorescent protein fragments. To determine the subcellular localization of target proteins, the target gene sequences were ligated into the pCAMBIA1302 vector under the control of the 35S promoter, generating the recombinant plasmid. The resulting constructs were used for transient assays via PEG transfection of Arabidopsis protoplasts as described by Yoo et al.^{81 (link)}. Transfected cells were imaged using a TCS SP2 confocal spectral microscope imaging system (Leica, Solms, Germany).