Sw620

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom, France, China, Austria

The SW620 is a laboratory centrifuge designed for general-purpose applications. It is capable of processing samples at high speeds to separate components based on density differences. The SW620 features variable speed control and can accommodate a range of rotor types to suit different sample volumes and tube sizes.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

SW620/FU (1 citations)

226 protocols using sw620

OTOP2 Knockdown in Colorectal Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CRC cell lines including HT29 and SW620 cells were purchased from the ATCC company (Manassas, USA). The HT29 and SW620 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS, Thermo Fisher Scientific, Waltham, USA) in a humidified incubator with 5% CO₂ at 37°C.
The siRNAs targeting OTOP2 (named si-OTOP2#1 and si-OTOP2#2) were synthesized by Ribobio (Guangzhou, China). The respective scrambled siRNA (named si-NC) was used as the negative control. For the cell transfections, the siRNAs (si-NC, si-OTOP2#1 or si-OTOP2#2) were transfected into the HT29 or SW620 cells by using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s protocol.

Guo S, & Sun Y. (2022). OTOP2, Inversely Modulated by miR-3148, Inhibits CRC Cell Migration, Proliferation and Epithelial–Mesenchymal Transition: Evidence from Bioinformatics Data Mining and Experimental Verification. Cancer Management and Research, 14, 1371-1384.

+ Open protocol

+ Expand

Maintaining Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human lung adenocarcinoma cell line, HCC827, the human pancreatic ductal adenocarcinoma cell line, PANC-1, and human the colorectal adenocarcinoma cell line, SW620, were purchased from ATCC (Manassas, VA) and maintained mycoplasma free at passage numbers <25 for all studies. The cell lines were expanded in their respective optimal growth media (HCC827: RPMI 1640 [ThermoFisher Scientific] + 10% fetal bovine serum [FBS] + 1% penicillin/streptomycin/glutamine; PANC-1: DMEM [ThermoFisher Scientific] + 10% FBS + 1% penicillin/streptomycin/glutamine; SW620: Leibovitz L-15 [ThermoFisher Scientific] + 10% FBS + 1% penicillin/streptomycin/glutamine) and stored at 37 °C in either a 5% (HCC827 and PANC-1) or 0% (SW620) CO₂ incubator.

McMahon N.P., Solanki A., Wang L.G., Montaño A.R., Jones J.A., Samkoe K.S., Tichauer K.M, & Gibbs S.L. (2024). In situ single-cell therapeutic response imaging facilitated by the TRIPODD fluorescence imaging platform. Theranostics, 14(7), 2816-2834.

+ Open protocol

+ Expand

Colon Cancer Cell Culture and miR-1180-3p Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human normal colon epithelial cells FHC and CRC cells (HCT116, Caco2, LoVo, SW480, SW620) were all obtained from American Type Culture Collection (USA). SW480 and SW620 cells were cultured in L-15 Medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich, USA) in an atmosphere of 100% air. FHC, HCT116, Caco2, and LoVo cells were cultured in RPMI-1640 cell culture medium (Gibco, USA) supplemented with 10% FBS (Sigma-Aldrich, USA) in a humidified incubator containing 5% CO₂.
HCT 116 and SW620 cells were subjected to transfection. They were seeded in six-well plates to achieve about 80% of the cell confluence. The sequences of mature miR-1180-3p (miR-1180-3p mimic) and negative control of mimic (NC-mimic) were synthesized and purified by Beijing Generaybiotech (Beijing, China). miR-1180-3p mimic or NC-mimic was transfected into HCT 116 and SW620 cells using Lipofectamine 3000 reagent (Invitrogen, USA) as per the instructions.
RNA from cells was extracted via Trizol (Invitrogen) following the user guide from the manufacturer.

Li C., Jin W., Zhang D, & Tian S. (2021). Clinical significance of microRNA-1180-3p for colorectal cancer and effect of its alteration on cell function. Bioengineered, 12(2), 10491-10500.

+ Open protocol

+ Expand

Silencing LUCAT1 in Colorectal Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

CRC cell lines SW620 and SW480 were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). SW620 and SW480 cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA) supplied with 100 U/mL penicillin and 1 μg/mL streptomycin (Invitrogen), 10% fetal bovine serum (Invitrogen, shanghai, China) at 37°C with 5% CO₂. The LUCAT1 and negative control siRNAs (Invitrogen, Carlsbad, CA) were transfected into SW620 and SW480 cells using RNAiMAX (Invitrogen) according to the manufacturer's instructions. Forty‐eight hours after transfection, the cells were harvested for RNA extraction. The LUCAT1 siRNA sequences are as follows: siRNA 1#, 5′‐CCCAUCAGAAGAUGUCAGAAGAUAA‐3′; siRNA 2#, 5′‐CAAGCUCUUGCAGUCAACAAGAACU‐3′.

Chen Y., Yu X., Xu Y, & Shen H. (2017). Identification of dysregulated lncRNAs profiling and metastasis‐associated lncRNAs in colorectal cancer by genome‐wide analysis. Cancer Medicine, 6(10), 2321-2330.

+ Open protocol

+ Expand

Establishment and Maintenance of Colorectal Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human CRC cell line SW620 was purchased from the American Tissue Culture Collection (Manassas, VA, USA). Human CRC cell lines HCT116 and SW480 were purchased from DS Pharmabiomedical (Osaka, Japan). L-OHP-resistant SW620 (SW620-OxR) cells were prepared as previously reported [9 (link)]. SW620, SW620-OxR, and SW480 cells were grown in Leibovitz's L-15 medium (Life Technologies Corp., Carlsbad, CA, USA) plus 10% fetal bovine serum (FBS) (Sigma-Aldrich, St. Louis, MO, USA), 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C in 100% air. SW620-OxR cells were grown with 80 μM L-OHP (Tokyo Chemical Industry Co., Tokyo, Japan) and were cultured without L-OHP for 1 passage before experiments. HCT116 cells were grown in McCoy's 5A medium (Life Technologies Corp.) plus 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C in 5% CO₂ air.

Tanaka S., Hosokawa M., Miyamoto T., Nakagawa A., Haruna M., Ueda K., Iwakawa S, & Ogawara K.I. (2021). miR-33a-5p in small extracellular vesicles as non-invasive biomarker for oxaliplatin sensitivity in human colorectal cancer cells. Biochemistry and Biophysics Reports, 26, 100996.

+ Open protocol

+ Expand

Colon Cancer Cell Line Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two colon cancer cell lines, SW620 and SW480 (ATCC, Manassas, VA, USA)14 , were studied along with the normal human colon mucosal epithelial cell line NCM-460, which was used as a control. All cell lines were incubated with RPMI-1640 (Gibco, Gaithersburg, MD, USA) containing 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Carlsbad, CA, USA), 100 U/ml penicillin, and 100 μg/ml streptomycin (Sigma-Aldrich, St. Louis, MO, USA) at 37°C in a 5% CO₂ atmosphere. For transfection, SW620 and SW480 cells were seeded in six-well plates at a cell density of 70%–90% and transfected with Lipofectamine™ 3000 reagent (Thermo Fisher) and miR-324-5p mimic (5′-UGUGGU-UACGGGAUCCCCUACGC-3′)15 (link) or miR-324-5p inhibitor (5′-ACACCAAUGCCCUAGGGGAUGCG-3′)16 according to the manufacturer’s instructions. Nonhomologous miRNA mimic control was used as the negative control (NC).

Gu C., Zhang M., Sun W, & Dong C. (2019). Upregulation of miR-324-5p Inhibits Proliferation and Invasion of Colorectal Cancer Cells by Targeting ELAVL1. Oncology Research, 27(5), 515-524.

+ Open protocol

+ Expand

Culturing Colon Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The RKO, SW480, Lovo, HCT15, SW48, LS174T, SW620, LS180 and HCT116 colon cancer cell lines were used in this study and all were obtained from the American Type Culture Collection (Manassas, VA, USA). The cells were cultured in the recommended media (Dulbecco's modified Eagle's medium; Thermo Fisher Scientific, Inc., Waltham, MA, USA) for RKO, LS174T and LS180 and Roswell Park Memorial Institute-1640 medium (Sigma-Aldrich; Thermo Fisher Scientific, Inc.) for SW480, Lovo, HCT15, SW48, SW620 and HCT116 supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Inc.). Cells were maintained in a 37°C incubator in an atmosphere containing 5% CO₂. Cells were regularly monitored using a light microscope and subcultured once they reached 80–90% confluency.

Matsumoto Y., Saito M., Saito K., Kanke Y., Watanabe Y., Onozawa H., Hayase S., Sakamoto W., Ishigame T., Momma T., Kumamoto K., Ohki S, & Takenoshita S. (2017). Enhanced expression of KIF4A in colorectal cancer is associated with lymph node metastasis. Oncology Letters, 15(2), 2188-2194.

+ Open protocol

+ Expand

Cancer Cell Line Cultivation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Colon cancer cell lines HCT116, LoVo, SW480, gastric cancer cell lines AGS, BGC823, MGC803, lung cancer cell lines A549, H1299, PG, esophageal cancer cell line EC9706, pancreatic cancer cell lines ASPC-1, PANC-1, SW1990, liver cancer cell lines BEL7402, HEPG2, SMMC7721 were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). Esophageal cancer cell KYSE30-lm3 and KYSE450-lm2 were gifted by Professor Zhihua Liu (Cancer Institute, Cancer Hospital, Chinese Academy of Medical Sciences). Primary human fibroblasts IMR90 was obtained from Cell Center, Chinese Academy of Medical Science.
HEPG2, PANC-1, SW1990, EC9706, KYSE30-lm3, KYSE450-lm2 and IMR90 were cultured in Dulbecco's modified Eagles medium (DMEM) (ThermoFisher Scientific, Inc.) with 10% fetal bovine serum (Biology industries). AGS, MGC803, BG823, HCT116, SW620, SW480, A549, H1299, PG, BEL7402 and SMMC7721 were cultured in RPMI-1640 medium (ThermoFisher Scientific, Inc.) with 10% fetal bovine serum.

Sun S., Meng L., Xing X., Li N., Song Q., Qiao D., Qu L., Liu C., An G., Li Z., Shou C, & Lian S. (2023). Anti-PRL-3 Monoclonal Antibody inhibits the Growth and Metastasis of colorectal adenocarcinoma. Journal of Cancer, 14(13), 2585-2595.

+ Open protocol

+ Expand

Colon Cancer Cell Line Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

The colon cancer cell lines (SW620, LoVo, SW480, HCT116, SW48, HCT15, RKO, SW837, COLO-201, COLO-205, LS174T and LS180) used in the present study were originally obtained from the American Type Culture Collection (Manassas, VA, USA). The cells were cultured in the recommended media (Dulbecco's modified Eagle's medium (Thermo Fisher Scientific, Inc., Waltham, MA, USA) for RKO, LS174T and LS180 and RPMI-1640 medium (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for SW480, Lovo, HCT15, SW48, SW620 and HCT116 supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Inc.). The monolayer cells were maintained in a 37°C incubator with 5% CO₂, observed regularly under a light microscope (magnification, ×40) and subcultured when they reached 80–90% confluency.

Kikuchi D., Saito M., Saito K., Watanabe Y., Matsumoto Y., Kanke Y., Onozawa H., Hayase S., Sakamoto W., Ishigame T., Momma T., Ohki S, & Takenoshita S. (2017). Upregulated solute carrier family 37 member 1 in colorectal cancer is associated with poor patient outcome and metastasis. Oncology Letters, 15(2), 2065-2072.

+ Open protocol

+ Expand

Culturing Colorectal Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cell lines, HCT-116, SW116, SW480, SW620, and HT29, used in the present study were purchased from American Type Culture Collection. HCT-116 was cultured in Ham’s F12K medium (Thermo Fisher Scientific, U.S.A.) containing 10% FBS (Life Technologies, Grand Island, U.S.A.). SW480 and SW620 were cultured in Leibovitz’s L-15 medium (Thermo Fisher Scientific, U.S.A.) containing 10% FBS (Life Technologies, GrandIsland, U.S.A.). SW116 and HT-29 cells were cultured in RPMI-1640 medium (Thermo Fisher Scientific, U.S.A.) containing 10% FBS (Life Technologies, Grand Island, U.S.A.). Cells were maintained at 37°C in a humidified atmosphere with 5% CO₂.

Meng Y, & Yu F. (2019). Long noncoding RNA FAM3D-AS1 inhibits development of colorectal cancer through NF-κB signaling pathway. Bioscience Reports, 39(7), BSR20190724.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!