Iscript rt kit

Manufactured by Bio-Rad

Sourced in United States

The IScript RT kit is a reverse transcription kit designed for the conversion of RNA to cDNA. It includes all the necessary components for efficient and reliable reverse transcription reactions.

Automatically generated - may contain errors

Lab products found in correlation

40 protocols using iscript rt kit

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells using a kit from Qiagen. 1 μg RNA was subjected to reverse transcription and quantitative PCR (qPCR) using iScript RT kits and SYBR green master mix (Bio-Rad). The U6 or GAPDH were used as an internal control. The sequences of primers were listed in the Supplementary Table S2.

Wu N., Yuan Z., Du K.Y., Fang L., Lyu J., Zhang C., He A., Eshaghi E., Zeng K., Ma J., Du W.W, & Yang B.B. (2019). Translation of yes-associated protein (YAP) was antagonized by its circular RNA via suppressing the assembly of the translation initiation machinery. Cell Death and Differentiation, 26(12), 2758-2773.

+ Open protocol

+ Expand

Total RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells or tissues using a kit from Geneaid TriRNA isolation kit or TRIzol. 1 μg RNA was subjected to reverse transcription and quantitative PCR (qPCR) using iScript RT kits and SYBR green master mix (Bio-Rad). U6 or GAPDH were used as internal controls. The sequences of primers are listed in Table S2. RNase treatment was conducted as previously described.⁴¹ (link) In brief, 1 μg RNase R (Epicenter) or RNase A (QIAGEN) was added in the mixture either before or after immunoprecipitation and incubated at 37°C for 15 min.

Wu N., Xu J., Du W.W., Li X., Awan F.M., Li F., Misir S., Eshaghi E., Lyu J., Zhou L., Zeng K., Adil A., Wang S, & Yang B.B. (2020). YAP Circular RNA, circYap, Attenuates Cardiac Fibrosis via Binding with Tropomyosin-4 and Gamma-Actin Decreasing Actin Polymerization. Molecular Therapy, 29(3), 1138-1150.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was purified using an RNeasy Mini Kit (QIAGEN, Valencia, CA). Reverse transcription reaction was performed for each sample (1 μg of RNA) via iScript RT kit (Bio-Rad) per the manufacturer's protocol. Real-time PCR was carried using the iTaq Universal SYBR Green PCR master mix in a 20 μL total volume. The PCR primer sequences and conditions for human Fyn [37 (link)], Egr-1 [76 (link)], NOX-4 [45 (link)] and p47phox [45 (link)] were previously described. Relative gene expression was calculated by determination of the cycle threshold (C_t) value and normalizing to actin C_t values.

Irwin M.E., Johnson B.P., Manshouri R., Amin H.M, & Chandra J. (2015). A NOX2/Egr-1/Fyn pathway delineates new targets for TKI-resistant malignancies. Oncotarget, 6(27), 23631-23646.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

After each LAB was grown in CDM with MPL (0 and 0.5%), the bacterial pellet was recovered as previously described. Two milliliters of each bacterial culture was used for RNA extraction. Isolation of RNA was performed using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) following the manufacturer's instructions. The iScript RT kit (Bio-Rad) was used to synthesize cDNA from 1 mg of RNA.

Rocha-Mendoza D., Kosmerl E., Miyagusuku-Cruzado G., Giusti M.M., Jiménez-Flores R, & García-Cano I. (2020). Growth of lactic acid bacteria in milk phospholipids enhances their adhesion to Caco-2 cells. Journal of dairy science, 103(9).

+ Open protocol

+ Expand

RNA Extraction and Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from cell pellets was isolated using RNeasy Plus Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. RNA concentration was analyzed using BopPhotometer (Eppendorf, Hamburg, Germany). For the reverse transcription of 1 µg RNA the iScript RT kit (Bio-Rad, Hercules, CA, USA) was utilized. One microliter of the transcribed cDNA per reaction was used for qRT-PCR analysis.

Bechmann N., Ehrlich H., Eisenhofer G., Ehrlich A., Meschke S., Ziegler C.G, & Bornstein S.R. (2018). Anti-Tumorigenic and Anti-Metastatic Activity of the Sponge-Derived Marine Drugs Aeroplysinin-1 and Isofistularin-3 against Pheochromocytoma In Vitro. Marine Drugs, 16(5), 172.

+ Open protocol

+ Expand

TMEM16A Isoform Expression in Human Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

One microgram of total RNA derived from 18 different human tissues (Human Total RNA Master panel II, Clontech) was retro-transcribed using IScript RT kit (Biorad) and subsequently amplified by PCR.
PCR conditions for the normal 5′-end of TMEM16A and for beta-2 microglobulin were: initial denaturation at 95 °C for 5 min for the initial denaturation; 30 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 40 s; final extension at 72 °C for 7 min. PCR conditions for the alternative 5′-end of TMEM16A were: initial denaturation at 95 °C for 5 min; 30 cycles of 95 °C for 30 s, 63 °C for 30 s, and 72 °C for 40 s; final extension at 72 °C for 7 min.
We used the following forward and reverse primers for the normal TMEM16A 5′-end: 5′-GGCGGTCCCAGCGCACAG and 5′-CCGGTTGCCCGAGGGCC. For the alternative TMEM16A 5′-end the primers were: 5′-GCCGGCACCAAATGCTGACCA and 5′-CCGGTTGCCCGAGGGCC. For beta-2 microglobulin, the primers were: 5′-GCGCTACTCTCTCTTTCTGG and 5′-GATGCCGCATTTGGATTGGA.
The amplified products (260 bp for normal TMEM16A; 286 bp for the alternative TMEM16A, and 371 bp for beta-2 microglobulin) were resolved on 1.5% agarose gels. The identity of bands detected in testis and lung were verified by sequencing.

Sondo E., Scudieri P., Tomati V., Caci E., Mazzone A., Farrugia G., Ravazzolo R, & Galietta L.J. (2014). Non-canonical translation start sites in the TMEM16A chloride channel. Biochimica et Biophysica Acta, 1838(1), 89-97.

+ Open protocol

+ Expand

Astrocyte Inflammation Response Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Confluent primary astrocytes cultures from Ikbk2^F/F and hGfapcre/Ikbk2^F/F mice were treated with saline or 10 μM MPTP and 10 pg/mL TNF and 1 ng/mL IFNγ for 8 hours. Cells were then rinsed with cold PBS and RNA was isolated from glia utilizing the RNeasy Mini Kit (QIAGEN, Valencia, CA) with purity and concentration confirmed using a NanoDrop ND-1000 spectrophotometer. Five hundred ng of RNA was used as a template for reverse transcriptase reactions using the iScript RT kit (Bio-Rad) cDNA was mixed with SYBR Green (Bio-Rad) with primer pairs for Tnf, Nos2, interleukin 1-beta (Il-1β), interleukin 6 (Il-6), chemokine-like ligand 2 and 5 (Ccl2 and Ccl5) as published previously (Kirkley et al., 2017 (link)).

Kirkley K.S., Popichak K.A., Hammond S.L., Davies C., Hunt L, & Tjalkens R.B. (2019). Genetic Suppression of IKK2/NF-κB in Astrocytes Inhibits Neuroinflammation and Reduces Neuronal Loss in the MPTP-Probenecid Model of Parkinson’s Disease. Neurobiology of disease, 127, 193-209.

+ Open protocol

+ Expand

Gene Expression Analysis in Hgf-Cdk4R24C Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression of selected genes was analyzed in six new Hgf-Cdk4^R24C cell lines, MB49 cells and urothelium scrape from healthy Hgf-Cdk4^R24C bladder. Briefly, RNA was isolated using the Total RNA Purification Kit (Norgen Biotek cat. 17200) and DNase column treatment (Norgen Biotek cat. 25710) was performed according to the manufacturer’s instructions. The RNA concentration was quantified using NanoDrop Spectrophotometer (Thermo Fisher Scientific) and 1.5 μg of RNA was reverse-transcribed into cDNA in a 30 μl reaction using the iScript RT kit (Bio-Rad cat. 170–8890) according to the manufacturer’s instructions. Gene expression was determined using qRT-PCR with Sybr Green detection and PowerUp Master mix (Thermo Fisher cat. A25742) on a CFX384 Touch detection system (Bio-Rad). The primer pairs (S1 Table) were designed by us and ordered from Integrated DNA Technologies. The qPCR conditions consisted of 2 minutes initial activation at 50°C, 2 minutes denaturation at 95°C, followed by 40 cycles of 20 seconds denaturation at 95°C, 20 sec annealing at 55°C and 60 sec of extension at 72°C. After the completion of all cycles a final extension step for 10 minutes at 72°C was applied and melting curves were generated.

Kerzeli I.K., Lord M., Doroszko M., Elgendy R., Chourlia A., Stepanek I., Larsson E., van Hooren L., Nelander S., Malmstrom P.U., Dragomir A., Segersten U, & Mangsbo S.M. (2021). Single-cell RNAseq and longitudinal proteomic analysis of a novel semi-spontaneous urothelial cancer model reveals tumor cell heterogeneity and pretumoral urine protein alterations. PLoS ONE, 16(7), e0253178.

+ Open protocol

+ Expand

Immunoglobulin Repertoire Analysis of B-cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was isolated from: blood CD19+CD138+and CD19+Cd138− and pop A, B, D from one blood after tetanus vaccination and 3 BM using the RNeasy Mini Kit (Qiagen, Inc. Valencia, CA) by following the manufacturer's protocol. Approximately 400 pg of RNA was subjected to reverse transcription using the iScript RT kit (BioRad, Inc., Hercules, CA). Resulting cDNA products were included with 50nM VH1-VH6 specific primers and 250nM Ca, Cm, and Cg specific primers in a 20 μl PCR reaction using High Fidelity Platinum PCR Supermix (Life Technologies, Carlsbad, CA) and amplified by 40 cycles. Nextera indices were added and products were sequenced on an Illumina MiSeq with a depth of approximately 300,000 sequences per sample. One BM sample was used as a control and 20,000 pop D cells were collected and RNA was isolated and NGS was performed as described above. For all sequences were aligned with IMGT.org/HighVquest (Alamyar et al., 2012 ). Sequences were then analyzed for V region mutations and clonality. All clonal assignments were based on matching V and J regions, matching CDR3 length, and 70% CDR3 homology. All sequences are plotted using Matlab or Circos visualization tools (Krzywinski et al., 2009 (link)).

Halliley J.L., Tipton C., Liesveld J., Rosenberg A.F., Darce J., Gregoretti I.V., Popova L., Kaminiski D., Fucile C.F., Albizua-Santin I., Kyu S., Chiang K.Y., Bradley K.T., Burack R., Slifka M., Hammarlund E., Wu H., Zhao L., Walsh E.E., Falsey A.R., Randall T.D., Cheung W.C., Sanz I, & Lee F.E. (2015). Long-lived Plasma Cells Are Contained Within the CD19−CD38hiCD138+ Subset in Human Bone Marrow. Immunity, 43(1), 132-145.

+ Open protocol

+ Expand

Gene Expression Analysis of Periodontitis in T2DM

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from Mφ isolated from gingival tissue of periodontitis-affected sites (presence of BoP, PD ≥5 mm, and CAL ≥3 mm) and healthy sites (no BoP, PD ≤3 mm, and no CAL) of eight T2DM and seven non-diabetes subjects using a Zymo kit (Zymo Research Corporation, Irvine, CA, USA). The ratios of absorbance (260/280 and 260/230) were used to determine RNA quality. cDNA was transcribed from lμg of total RNA, using an iScript RT kit (Bio-Rad, Hercules, CA, USA). SYBR Green-based qRT–PCR was performed by use of a CFX Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The ΔΔCT method was used for gene quantification. 18S was used as an endogenous normalizer. The primer sequences were as follows: RELA Forward Primer (5′−3′): ATGTGGAGATCATTGAGCAGC; RELA Reverse Primer (5′−3′): CCTGGTCCTGTGTAGCCATT; RFX5 Forward Primer (5′−3′): GATGAGCCTGATGCTAAGAGC; RFX5 Reverse Primer (5′−3′): GGGAGCTGAAGGTAGAGATACA; RUNX2 Forward Primer (5′−3′): TGGTTACTGTCATGGCGGGTA; RUNX2 Reverse Primer (5′−3′): TCTCAGATCGTTGAACCTTGCTA; 18S Forward Primer (5′−3 ′): GACCTCATCCCACCTCTCAG; 18S Reverse Primer (5′−3′): CCATCCAATCGGTAGTAGCG.

Agrafioti P., Morin-Baxter J., Tanagala K.K., Dubey S., Sims P., Lalla E, & Momen-Heravi F. (2022). Decoding the role of macrophages in periodontitis and type 2 diabetes using single-cell RNA-sequencing. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 36(2), e22136.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!