The four IFN-γ SNPs(764G/C, −1616T/C, +874A/T and +3234C/T), as the gene expression involved based on the other functional experiments, were selected. Genomic DNA was extracted from peripheral blood using QIAamp DNA Blood Mini Kit (Qiagen, Dusseldorf, Germany) according to the manual and stored at −20°C before use. The primers (Table 1 ) for polymerase chain reaction (PCR) amplification and Snapshot extension reactions were designed by the Primer Premier 5 program and the sequence from the gene bank of the National Center for Biotechnology Information (NCBI). Every PCR amplicon was confirmed by agarose electrophoresis for fragment size and detailed by sequencing on an ABI 3130XL sequencer (Applied Biosystems, ABI, California, USA). PCR was performed using the Hot Star Taq kit (Qiagen). PCR products were purified using shrimp alkaline enzyme (SAP) (Promega, Wisconsin, USA) and exonuclease I (EXO I) (EpiCentre, Palmerston North, New Zealand) according to the manufacturers’ instructions and were used as a template for extension. Extension was performed using a commercial kit for Snapshot Multiplex reaction (ABI), and the products were purified using SAP (Promega) and loaded onto an ABI 3130XL sequencer for sequencing. The raw data from the ABI 3130XL sequencer were subjected to analysis with GeneMapper 4.0 (ABI).
Abi 3130xl sequencer
Manufactured by Thermo Fisher Scientific
Sourced in United States, Italy
The ABI 3130XL Genetic Analyzer is a capillary electrophoresis-based DNA sequencing instrument. It is designed to perform automated DNA sequencing and fragment analysis. The ABI 3130XL has 4 capillary channels and can process multiple samples simultaneously.
Automatically generated - may contain errors
Lab products found in correlation
Bigdye terminator v3.1 kit, by Thermo Fisher Scientific (9 mentions)
Genemapper 4, by Thermo Fisher Scientific (7 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (5 mentions)
Bigdye terminator cycle sequencing kit, by Thermo Fisher Scientific (5 mentions)
Seqscape v2, by Thermo Fisher Scientific (5 mentions)
Qiaamp dna blood mini kit, by Qiagen (4 mentions)
Exosap it, by Thermo Fisher Scientific (3 mentions)
Genemapper v4, by Thermo Fisher Scientific (3 mentions)
Aligner, by CodonCode (3 mentions)
Exonuclease 1 exo 1, by Illumina (2 mentions)
Hotstartaq kit, by Qiagen (2 mentions)
Qiaquick gel extraction kit, by Qiagen (2 mentions)
Illustra gfx pcr dna and gel band purification kit, by GE Healthcare (2 mentions)
Seqscape software v2, by Thermo Fisher Scientific (2 mentions)
Pgem t easy vector, by Promega (2 mentions)
Bigdye terminator sequencing kit, by Thermo Fisher Scientific (2 mentions)
Afliii, by New England Biolabs (2 mentions)
Gc 1 buffer, by Takara Bio (2 mentions)
Multiple pcr primers, by Sangon (2 mentions)
Haeii, by New England Biolabs (2 mentions)
86 protocols using abi 3130xl sequencer
1
Genotyping of IFN-γ Gene Variants
2
Sanger Sequencing of Candidate Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The candidate variants identified above were validated by Sanger sequencing. The polymerase chain reaction (PCR) primers (forward: 5′-TGATGTGGGTTGTGTAAT GG-3′; reverse: 5′-AAGGGAACCAGAGCACCAG-3′) were designed using Primer 31 . For each fragment, PCR was conducted in a total reaction volume of 25 μL containing approximately 200 ng of genomic DNA, 12.5 μL of 2 × GC buffer I, 2.5 mmol/L MgCl2, 0.2 mmol/L dNTPs, 40 U/mL Taq DNA polymerase (Takara, Dalian, China), and 0.4 μmol/L of each primer. The PCR products were amplified for 35 cycles of the following: 95°C, 30 s; 60°C, 30 s; and 72°C, 50 s using an Eppendorf Mastercycler® Pro thermal cycler (Eppendorf, Hamburg, Germany). PCR products were then subjected to DNA sequencing on an ABI 3130XL sequencer.
3
Allelic Ratio Determination by SNaPshot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ABI Prism SNaPshot ddNTP Primer extension kit (Life Technologies, #4323159) was used for determination of allelic ratios of mRNA transcripts (after reverse transcription into cDNA) as stated in the manufacturer’s instructions. Genomic DNA of the same sample tissue was used as reference. The reaction products were analyzed on an ABI 3130XL sequencer (Applied Biosystems) and electropherograms were analyzed using Gene Mapper 4.0 software (Applied Biosystems). Allelic ratios of cDNA were normalized to ratios obtained with genomic DNA from the same sample. Data are presented as bee swarm boxplots calculated using the respective packages provided by The R Project for Statistical Computing. In the boxplots, the median and quartiles are indicated. The p-values were calculated in R using Welch’s unequal variances t-test. Primer sequences are listed in S5 Table .
4
Analytical Pipeline for Rare FBN1 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All identified rare variants in FBN1 were bidirectionally sequenced by ABI 3130XL sequencer (Applied Biosystems, Foster City, CA). Variant frequency was compared with 4 major SNP databases: ESP6500 (http://evs.gs.washington.edu/EVS/ ), 1000G (http://www.1000genomes.org/ ), dbSNP132 (http://www.ncbi.nlm.nih.gov/projects/SNP/ ) and 1500 Chinese Han in-house database. Deleterious effect of each variant was assessed by various algorithms, such as SIFT (http://sift.bii.a-star.edu.sg/ ), PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/ ) and MutationTaster (http://www.mutationtaster.org/ ). Signal peptide analysis was evaluated by SignalP 4.1 Server (http://www.cbs.dtu.dk/services/SignalP/ ).
5
Sequence Analysis of Genetic Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR products were purified using Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA). Both chains of each product were sequenced using the same primers as for PCR using the BigDye Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems) in an ABI3130XL Sequencer (Applied Biosystems), Unidad Genómica, INTA Castelar, Argentina. The sequences were edited using the software BioEdit version 5 (Hall 1999 ), and homology analyses were performed with the BLASTN program (http://www.ncbi.nlm.- nih.gov / BLAST /). The sequences were then aligned by means of the MEGA program version 4.0 using the ClustalW algorithm. The nucleotide sequences for each subregion were translated to their corresponding amino acids with DNAman version 4.13. The sequences were then aligned and compared with the reference sequence and other sequences (Fig. 1 ). The sequence pair distances were calculated by DNAstar (Tamura et al. 2007 (link)). The phylogenetic trees were constructed using the MEGA program with the neighbor joining (NJ) method, and bootstrap analyses were conducted using 1,000 replicates. Evolutionary distances were computed using the maximum composite likelihood method (Tamura et al. 2007 (link)). To perform phylogenetic reconstruction of amino acids, 15 taxa were used with the NJ method and Bootstrap of 1,000 replicates with Poisson correction.
6
Sequencing of EDN3 Gene Exons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A ~1-kb genomic fragment encompassing exons 4 to 5 of EDN3 was amplified and sequenced with the previously reported primer pair AS044F and AS044R [12 ]. PCR was conducted under reaction conditions listed under “PCR4” in S2 Table . Amplified PCR products were purified by isopropanol precipitation and directly sequenced. For heterozygous sequences, the PCR products were cloned into pMD20, and eight clones for each product were sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems) with M4 and Rv universal primers on an ABI 3130xl sequencer (Applied Biosystems).
7
Genome Sequencing and Mutation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We previously reported the complete genome sequence for the Methanothermobacter sp. CaT2, which is available at DDBJ/EMBL/GenBank, accession numbers AP011952.1 and AP011953.1 (15 (link)). To identify the mutation sites of CLA160, we performed genome sequencing of CLA160 using the Illumina Hiseq 2000 platform and mapped this against the complete genome sequence of CaT2. The genome sequencing of CLA160 was performed as previously reported (21 (link)). A total of 6,207,761 sequence pairs of 100 bp paired-end nucleotide reads from CLA160 were obtained, which yielded approximately 717-fold sequence coverage. The Illumina sequencing reads of CLA160 were aligned with the CaT2 genome sequence using BWA (17 (link)). Mutation sites were searched for using the Genome Analysis Toolkit (GATK) v 2.1.8 (22 (link)). Predicted mutation sites were analyzed by direct sequencing using appropriate primers: for 1022836, CLAm02_F: GAATATGGGTCTCGCCGTTA, CLAm02_R: AGG TAATGGCACCATTTCAGG; for 1180340, CLAm13_F: CCGA TACAGAGAAGACCCTCC, CLAm13_R: CAGCATATTACTTG AGGCGACAG; and for 1614615, CLAm14_F: CACAAGTGCCTTCATGGTTAC, CLAm14_R: TGTCTCATGCACACATCACC. Direct sequencing was performed using an ABI 3130XL sequencer (Applied Biosystems, California, USA) with a Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), according to the manufacturer’s instructions.
8
HEV Genotyping via Sequencing and Phylogenetic Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR products were purified (Exo-SAP-IT kit; USB, Affymetrix, USA) and used as sequencing templates (BigDye terminator v.1.1 sequencing kit; Applied Biosystems, USA, ABI 3130XL sequencer). HEV genotyping was performed by phylogenetic analyses based on the amplified ORF2 sequences using the MEGA 5 software (www.megasoftware.net ). HEV reference sequences were obtained from the NCBI GenBank database.
9
SNP Genotyping Accuracy Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The candidate single nucleotide polymorphisms (SNP) loci were subjected to the SNaPshot SNP test for genotyping. The sequences of the PCR primer pairs utilized to amplify sequences of genomic DNA are described in Additional file 1 : Table S1. An ABI3130XL sequencer and GeneMapper 4.0 software (Applied Biosystems, Co. Ltd., USA) were used to analyze the collected data. To confirm the accuracy of genotyping quality, random samples of 5% of cases and controls were genotyped twice by blinded laboratory personnel. The results of the repeated samples were more than 99% similar.
10
Genomic DNA Variant Confirmation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Variants selected by the above criteria were confirmed by conventional Sanger sequencing of patient genomic DNA using the BigDye terminator cycle sequencing kit (Applied Biosystems, Paisley, UK) on an ABI3130xl sequencer (Applied Biosystems) and analysed using Sequencing Analysis v.5.2 software (Applied Biosystems). This was used to confirm presence of the mutation and test whether the mutation segregated with the disease phenotype in the family in question.
Confirmed pathogenic mutations were deposited in the publicly available LOVD database (http://databases.lovd.nl/shared/ ).
Confirmed pathogenic mutations were deposited in the publicly available LOVD database (
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!