Verapamil

Manufactured by Selleck Chemicals

Sourced in United States

Verapamil is a laboratory instrument used for the measurement and analysis of various chemical and biological samples. It functions as a spectrophotometer, capable of detecting and quantifying the absorption or emission of light by substances in a sample. The core function of Verapamil is to provide accurate and reliable data on the properties and composition of the analyzed materials.

Automatically generated - may contain errors

Lab products found in correlation

Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions) Rpmi 1640 medium, by Thermo Fisher Scientific (2 mentions) Saos2, by Shanghai Cell Bank (1 mentions) Saos 2, by Thermo Fisher Scientific (1 mentions) Primary antibodies against n cadherin, by Cell Signaling Technology (1 mentions) Nanog, by Proteintech (1 mentions) Cyclin d1, by Cell Signaling Technology (1 mentions) Gapdh, by Cell Signaling Technology (1 mentions) β actin, by Cell Signaling Technology (1 mentions) Dimethyl sulfoxide (dmso), by Merck Group (1 mentions) Matrigel, by BD (1 mentions) Bca protein assay kit, by Beyotime (1 mentions) β catenin, by Abcam (1 mentions) Cyclin e, by Proteintech (1 mentions) Melphalan, by Merck Group (1 mentions) Posaconazole, by Merck Group (1 mentions) Ifosfamide, by Merck Group (1 mentions) Levetiracetam, by Merck Group (1 mentions) Itraconazole, by Merck Group (1 mentions) Sirolimus, by Merck Group (1 mentions)

8 protocols using verapamil

Comparative Analysis of Osteosarcoma Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

MNNG/HOS, U‐2OS, MG‐63, and Saos‐2 were obtained from Cell Bank of Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China). MNNG/HOS and MG‐63 cells were grown in α‐MEM (Hyclone), while Saos‐2 and U‐2OS were cultured in RPMI 1640 medium (Gibco) containing 10% FBS (Gibco) and 1% antibiotics (Penicillin and streptomycin). All the cells were grown at 37°C in a humidified incubator containing 5% CO2.
BD obtained from Shanghai Yuanye Bio‐Technology Co., Ltd (Shanghai, China), was dissolved in DMSO (Sigma‐ Aldrich) and stored at −20°C as single‐use aliquots. BCA protein assay kit was obtained from Beyotime. Matrigel was obtained from BD Bioscience. Verapamil and STAT3 inhibitor Stattic were obtained from Selleck. Primary antibodies against N‐cadherin, GAPDH, β‐actin, and cyclin D1 were purchased from Cell Signaling Technology. Antibodies against MMP‐9, MMP‐2, SHP1, STAT3, phospho‐STAT3 (Y105), JAK2, phospho‐JAK2 (Y1007, Y1008), CD133, Ki‐67, and β‐catenin were purchased from Abcam. Antibodies against Caspase 3, Bcl‐2, CDK2, CDK4, cyclin E, SOX‐2, OCT‐4, and Nanog were purchased from Proteintech.

Wang S., Hu H., Zhong B., Shi D., Qing X., Cheng C., Deng X., Zhang Z, & Shao Z. (2019). Bruceine D inhibits tumor growth and stem cell‐like traits of osteosarcoma through inhibition of STAT3 signaling pathway. Cancer Medicine, 8(17), 7345-7358.

+ Open protocol

+ Expand

Cytotoxic Agents and Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The J45.01 T-cell line and Toledo B-cell line were obtained from American Type Culture Collection (Manassas, VA). KBM3/Bu250⁶ is a busulfan-resistant AML cell line established in our laboratory as previously described [10 (link)]. MOLM14 is an AML cell line obtained from Dr. Michael Andreeff's laboratory (UT MD Anderson Cancer Center, Houston, TX). All cells were cultured in RPMI 1640 (Mediatech, Manassas, VA) supplemented with 10% heat-inactivated fetal bovine serum (FBS: Sigma-Aldrich, St. Louis, MO) and 100 U/mL penicillin and 100 μg/mL streptomycin (Mediatech) at 37°C in a humidified atmosphere of 5% CO₂ in air. 5-Carboxyfluorescein diacetate acetoxymethyl ester (5-CFDA) was purchased from Thermo Fisher Scientific, Inc. (Waltham, MA). Verapamil and MK571 were purchased from Selleckchem (Houston, TX). Chlorambucil, busulfan, melphalan, bendamustine, cyclophosphamide, ifosfamide, ketoconazole, posaconazole, fluconazole, itraconazole, metronidazole, ethacrynic acid, everolimus, sirolimus, phenytoin, levetiracetam, and buthionine sulphoximine (BSO) were obtained from Sigma-Aldrich Corp. (St. Louis, MO). 4-Hydroperoxycyclophosphamide (4-HC) and 4-hydroperoxyifosfamide (4-HI) were generous gifts from from Dr. Scott Rowley (Hackensack University Medical Center, Hackensack, New Jersey), and Dr. Robert F. Struck (Southern Research Institute, Birmingham, Alabama) respectively.

Valdez B.C., Hassan M, & Andersson B.S. (2017). Development of an assay for cellular efflux of pharmaceutically active agents and its relevance to understanding drug interactions. Experimental hematology, 52, 65-71.

+ Open protocol

+ Expand

Regulation of FOXO3a in Cancer Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Recombinant human TGFβ was purchased from R&D Systems (Minneapolis, MN). AKT inhibitor MK2206, proteasome inhibitor MG132 and verapamil were purchased from Selleck Chemicals (Houston, TX, USA). Primary antibodies against FOXO3a(AB_2636990, AB_836876), p-FOXO3a (Thr32)(AB_329842), p-FOXO3a (Ser253)(AB_2106674), SOX2 (AB_2799734), ABCG2 (AB_2799211), BMI1 (AB_2799353), CD44(AB_2076465), AKT(AB_10694382), p-AKT(Thr308)(AB_2800089), p-AKT(Ser473)(AB_2797780),ERK1/2 (AB_10693607),p-ERK1/2(Histone H3A (AB_331772) , and tubulin(AB_2799519) were obtained from Cell Signaling Technology (Danvers, MA, USA). Primary antibodies against FOXO3a (Chip grade, AB_298893) and IVL (AB_305656) were purchased from Abcam (Cambridge, MA, USA). All HRP-labeled secondary antibodies were also purchased from Cell Signaling Technology (Danvers, MA, USA). Hoechst 33342 was purchased from Sigma Aldrich (St Louis, MO, USA). Lentiviral particles were designed and synthesized by Hanbio (Shanghai, China). The sequences are listed below.

LV-RNAi1: 5′- GCACAACCTGTCACTGCATAG-3′

LV-RNAi2: 5′- GACTTCCGTTCACGCACCAATTCTA -3′

LV-RNAi3: 5′- GAGAACAAGCCAGCTACCTTCTCTT -3′

Scrambled sequence 5′-TTCTCCGAACGTGTCACGTAA-3′

Li K., Yang L., Li J., Guan C., Zhang S., Lao X., Ouyang D., Zheng G., Gao S., Wang D., Liang Y, & Liao G. (2019). TGFβ induces stemness through non-canonical AKT-FOXO3a axis in oral squamous cell carcinoma. EBioMedicine, 48, 70-80.

+ Open protocol

+ Expand

Analyzing Effects of Na+/K+ ATPase Inhibitor on Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

OS cell lines MG63 and U2OS cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were maintained in RPIM 1640 medium (Biological Industries, Kibbutz Beit Haemek, Israel) with 15% fetal bovine serum (FBS, Biological Industries) with in a humidified atmosphere with 5% CO₂ at 37°C. The Na+/K+ ATPase inhibitor ouabain was purchased from MedChem Express (Monmouth Junction, NJ), and concentrations of 5 nM, 10 nM, and 20 nM were used in this work. Azacitidine (5-AzaC) and verapamil were purchased from Selleck Chemicals and the concentrations of 50 nM and 5 μM were used, respectively.

Guo W., Wei B., Chen T., Xu X., Ruan F, & Xiang M. (2019). The Na+/K+ ATPase Inhibitor Ouabain Attenuates Stemness and Chemoresistance of Osteosarcoma Cells. Medical Science Monitor : International Medical Journal of Experimental and Clinical Research, 25, 9426-9434.

+ Open protocol

+ Expand

Boron-Doped Silicon Wafer Fabrication and Doxorubicin Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Boron-doped p-type silicon wafers (0.8–1.2 mΩ cm resistivity, 〈100〉 orientation) were produced from Virginia Semiconductor, Inc. (Fredericksburg, VA, USA). Doxorubicin hydrochloride (DOX·HCl, with purity > 98.0%) was obtained from Beijing HuaFeng United Technology CO., Ltd. (Beijing, China). RPMI 1640 medium, Dulbecco’s Modified Eagle’s Medium (DMEM), FBS, penicillin and streptomycin were provided by Gibco BRL/Life Technologies (Grand Island, NY, USA). Fibrinogen and thrombin were purchased from Searun Holdings Company (Freeport, ME, USA). Collagenase type I was purchased from Thermo Fisher Scientific (Waltham, MA, USA). Dispase II and TUNEL assay kit were purchased from F. Hoffmann-La Roche Ltd (Basel, Switzerland). Anti ICAM-1 antibody and anti P-gp antibody were purchased from ProteinTech (Wuhan, China). DIO, ionomycin, Hoechst 33342 and BCA protein quantification kit were purchased from Beyotime Biotechnology (Shanghai, China). Verapamil was provided by Selleck Chemicals (Houston, TX, USA). Cell counting kit (CCK-8) assay was obtained from Biosharp Company (Shanghai, China). DMA was purchased from Sigma-Aldrich (St Louis, MO, USA). All other reagents were of analytical grade and used without any further purification.

Yong T., Zhang X., Bie N., Zhang H., Zhang X., Li F., Hakeem A., Hu J., Gan L., Santos H.A, & Yang X. (2019). Tumor exosome-based nanoparticles are efficient drug carriers for chemotherapy. Nature Communications, 10, 3838.

+ Open protocol

+ Expand

Establishment of DOX-resistant Osteosarcoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

MG63, SaoS2, U2OS, 143B and MNNG/HOS cells were obtained from the Chinese Academy of Sciences Cell Bank (Shanghai, China) and cultured in Dulbecco's modified Eagle medium (DMEM) (Invitrogen Life Technologies, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum, penicillin (100 U/mL) and streptomycin (100 μg/mL) at 37°C in a 5% CO₂ incubator. For the establishment of MG63/DOX, a DOX-resistant cell line, the parental DOX-sensitive MG63 cell line was cultured in media containing increasing concentrations of DOX (from 5 nM to 100 nM) over six months. The resistant cells were incubated in DOX-free medium for at least seven days prior to the assays.
DOX, XAV939 and Verapamil were purchased from Selleck Chemicals (Houston, TX, USA) and dissolved in dimethyl sulfoxide (DMSO) (maximum concentration: 0.2%, Sigma-Aldrich, St. Louis, MO, USA) as a stock solution. rhPTN was obtained from PeproTech (Rocky Hill, NJ, USA).

Wu D., Liu L., Yan X., Wang C., Wang Y., Han K., Lin S., Gan Z, & Min D. (2017). Pleiotrophin promotes chemoresistance to doxorubicin in osteosarcoma by upregulating P-glycoprotein. Oncotarget, 8(38), 63857-63870.

+ Open protocol

+ Expand

Comprehensive Inflammation Regulation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Verapamil was obtained from Selleck Chemicals (S4202, Houston, TX, USA), and IL−1β was purchased from GenScript Technologies (Z03014, Piscataway, NJ, USA). Collagenase type I (LS004196, Worthington Biochemical Corp., Lakewood, NJ, USA) and ML385 (T4360, TargetMol, Shanghai, China) were also acquired. The antibodies employed included BAX (50599-2-Ig, Proteintech, Wuhan, China), BCL2 (26593-1-AP, Proteintech), MMP3 (17873-1-AP, Proteintech), MMP9 (10375-2-AP, Proteintech), MMP13 (18165-1-AP, Proteintech), COX2 (66351-1-Ig, Proteintech), β-actin (66009-1-Ig, Proteintech), IL6 (A11115, ABclonal, Wuhan, China), NRF2 (A21176, ABclonal), HO-1 (10701-1-AP, Proteintech), lamin B1 (12987-1-AP, Proteintech), P38 (14064-1-AP, Proteintech), P-P38 (28796-1-AP, Proteintech), ERK1/2 (11257-1-AP, Proteintech), P-ERK1/2 (28733-1-AP, Proteintech), P65 (10745-1-AP, Proteintech), P-P65 (AP0475, ABclonal), P-IκBα (AP0707, ABclonal), IκBα (A24909, ABclonal), anti-rabbit IgG (H+L) (DyLight™ 800 4X PEG conjugate) (5151, Cell Signaling Technology, Danvers, MA, USA), anti-mouse IgG (H+L) (DyLight™ 800 4X PEG conjugate) (5257, Cell Signaling Technology), anti-rabbit IgG (horseradish peroxidase (HRP) conjugate) (ab6721, Abcam, Cambridge, UK), anti-mouse IgG (horseradish peroxidase conjugate) (ab6789, Abcam), and anti-rabbit (Alexa Fluor^® 555 conjugate) (ab150078, Abcam).

Wang Z., Dong Z., Li Y., Jiao X., Liu Y., Chang H, & Gan Y. (2024). Verapamil Attenuates the Severity of Tendinopathy by Mitigating Mitochondrial Dysfunction through the Activation of the Nrf2/HO-1 Pathway. Biomedicines, 12(4), 904.

+ Open protocol

+ Expand

Quantitative Analysis of Drug Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols

ACY-1215 was provided by Acetylon Pharmaceuticals, Inc. (Boston, MA). Bortezomib, ibrutinib, romidepsin, verapamil and vorinostat were obtained from Selleck Chemicals (Houston, TX). All drugs were diluted in DMSO. Deuterated internal standard ibrutinib-d5 was purchased from TLC Pharmaceutical Standards Ltd (Ontario, Canada). All solvents and other chemicals for sample extraction were LCMS grade.

Amengual J.E., Prabhu S.A., Lombardo M., Zullo K., Johannet P.M., Gonzalez Y., Scotto L., Serrano X.J., Wei Y., Duong J., Nandakumar R., Cremers S., Verma A., Elemento O, & O'Connor O.A. (2016). Mechanisms of Acquired Drug Resistance to the HDAC6 Selective Inhibitor Ricolinostat Reveals Rational Drug : Drug Combination with Ibrutinib. Clinical cancer research : an official journal of the American Association for Cancer Research, 23(12), 3084-3096.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!