C57bl 6j mice

All animal procedures described in this study were performed using 8- to 16-week-old mice and were approved by the Institutional Animal Care and Use Committee of Soochow University (20140431). For platelet specific deletion of CLEC-2 expression, Clec2^fl/fl; Pf4-Cre mice were created by crossing Clec2^fl/flmice with Pf4-Cre mice (stock number 008535; C57BL/6J and Sv129 background; Jackson Laboratory). For hematopoietic deletion of PDPN expression, PDPN^fl/fl; LysM-Cre mice (Mye Pdpn^-/-) were created by crossing PDPN^fl/fl mice with LysM-Cre mice (stock number 004781; C57BL/6J and Sv129 background; Jackson Laboratory). Selplg^-/- mice were obtained from the Jackson Laboratory (stock number 004201, C57BL/6J background). ApoE^-/- mice (stock number T001782, C57BL/6J background), Ldlr^-/- mice (stock number T001464, C57BL/6J background), C57BL/6J mice (stock number N000013) and EGFP (stock number NM-TG-00005, C57BL/6J background) mice were purchased from Shanghai Model Organisms Center. All mice were housed in a pathogen-free facility at an ambient temperature of 22 °C to 25 °C, humidity and light cycle (12:12 h light: dark), and free access to water and food. All mice were backcrossed on C57BL/6J or Sv129 for > 10 generations.

Wild type C57BL/6J mice and Nlrc3 knockout (Nlrc3^−/−) mouse models were designed and developed by Shanghai Model Organisms Center, Inc (Shanghai, China). For obtaining Nlrc3^−/− mouse, Cas9 mRNA and sgRNAs were prepared by in vitro transcription. Two sgRNAs targeted to delete exons 2-3 of Nlrc3 gene: 5’- GTTGGTCTAATAAGCATCCTGGG -3’, 5’- TCCCATGAAACCATGTCAGAAGG -3’. Zygotes of C57BL/6J mice were received and injected with In vitro-transcribed Cas9 mRNA and sgRNAs and transferred to pseudopregnant recipients. The genotype of obtained F0 mice was identified and confirmed by PCR and sequencing using primer pairs: F-5’- GTGATGTCTGCTTACC CCGTCTCC -3’; R-5’- GCCTGTGCCGCCTCTCA -3’. By crossing with C57BL/6J mice, positive F0 mice were chosen for obtaining F1 heterozygous Nlrc3 knockout mice. PCR and sequencing analysis validated the obtained F1 mice. For obtaining the heterozygous Nlrc3^−/− mice, female and male F1 heterozygous mice were intercrossed randomly. Mice were aged 6–8 weeks were used for all studies.

All the animal procedures were approved by the Institutional Ethics Committee of the Fourth Military Medical University and were performed in compliance with the ARRIVE guidelines; the experiments were carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 8023, revised 1978). C57BL/6 J mice were obtained from the Experimental Animal Center of the Fourth Military Medical University, and transgenic mice were obtained from Shanghai Model Organisms Center, Inc (Shanghai, China). The mice were housed under a 12-hour light/12-hour dark cycle under pathogen-free conditions with free access to dry food and water for 1 week before the experiment.

Genetically modified C57BL/6J mice that express human full-length PD-1 protein (humanized PD-1 mice) were purchased from Shanghai Model Organisms Center (Shanghai, China). Mice were granted free access to a standard diet with drinking water before the experiment. All mice were housed under specific-pathogen-free facilities of the Korea Institute of Oriental Medicine (KIOM). All mice were housed in laboratory cage rack systems maintained at a constant temperature (22 ± 1°C) and humidity (50 ± 5%) under a 12-hour dark/light cycle. All experimental procedures followed the Guidelines for the Care and Use of Laboratory Animals of the National Institutes of Health of Korea and were approved by the Institutional Animal Care and Use Committee of KIOM (approval number KIOM-D-20-073).

Animal experiments were performed in accordance with the guidelines of the medical ethics committee of the School of Life Science and Health, Wuhan University of Science and Technology. Male C57BL/6J mice (7 weeks, about 19–22 g) were purchased from Shanghai Model Organisms. The caloric percentages of fat, protein and carbohydrate in the 60% high-fat diet (code TP23300) were 60%, 19.4% and 20.6%, respectively. The percentage of fat and protein in AIN93G standard feed (code: LAD3001G) were 16.7% and 19.3%, respectively. All the feeds were purchased from Trophic Animal Feed Technology Co., Ltd., Jiangsu, China. Mice were randomly divided into four groups (n = 9): normal diet group (ND group), high-fat diet group (HFD group), 50 mg/kg/d dietary tannic acid intervention group (HFD_TA 50 group) and 150 mg/kg/d dietary tannic acid intervention group (HFD_TA150 group). Mice in the ND and HFD groups were intragastrically given normal saline at the dose of 10 mL/kg/d, while mice in the intervention groups were intragastrically assigned dietary tannic acid solution at the amount of 50 mg/kg/d and 150 mg/kg/d at 10 am every day. During the experiment intervention period, animals were kept under an indoor temperature of 20–25 ℃ for 12 h light every day and allowed to eat and drink freely.

Twenty-four male C57BL/6J mice aged 31 weeks were purchased from Shanghai Model Organisms Center (Shanghai, China) and mice were allowed to adapt to one week. All mice were divided into three groups (eight animals per group) as follows: a UNT control mouse group, an MET group, and a HIIT group. Four mice were housed per cage, and they had access to standard rodent diet and water ad libitum. They were maintained under controlled temperature and humidity conditions, under a 12-h light/dark cycle. Our study lasted 24 weeks of the exercise training regimens, after which blood and heart tissue were collected. At the end of the study, the mice were euthanized with a high dose of pentobarbital (100 mg/kg, intraperitoneally), and lack of respiration and heartbeat was used as an indicator of mouse death. Serum was obtained by centrifuging clotted blood collected from the eye sockets of the mice and stored at −80°C. The heart tissue was snap-frozen in liquid nitrogen for mRNA isolation and immunoblotting analyses. All studies involving animal experimentation were followed the National Institutes of Health Guidelines on the Care and Use of Animals.