Log In Sign up
The largest database of trusted experimental protocols

The SSRT-IV is a laboratory instrument designed for the determination of the stress-strain characteristics of materials. It provides precise measurements of the mechanical properties of various materials, including metals, plastics, and composites. The SSRT-IV is a reliable and versatile tool for researchers and engineers in materials science and engineering.

Automatically generated - may contain errors

Lab products found in correlation

Purelink mirna isolation kit, by Thermo Fisher Scientific (1 mentions) All in one mirna qrt pcr detection kit, by GeneCopoeia (1 mentions) Gdna eraser, by Takara Bio (1 mentions) Quantitect sybr green rt pcr kit, by Qiagen (1 mentions) Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions) Tnf α, by Thermo Fisher Scientific (1 mentions) Caspase 8, by Thermo Fisher Scientific (1 mentions) Caspase 3, by Thermo Fisher Scientific (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Ab7500 real time pcr system, by Thermo Fisher Scientific (1 mentions) Mirna qrt pcr detection kit, by GeneCopoeia (1 mentions) Sybr green master mix, by Bio-Rad (1 mentions) Iq sybr green supermix, by Bio-Rad (1 mentions)

5 protocols using ssrt 4

1

Quantifying DCST1-AS1, Notch1, and miR-92a-3p

Check if the same lab product or an alternative is used in the 5 most similar protocols
HigherPurity™ Total RNA Extraction Kit (Canvax Biotech) was used to extract total RNAs from 105 HEC-1 cells or 0.05 g tissue samples. All RNA samples were digested with gDNA eraser (Takara) and RNA concentrations were measured using NanoDrop™ 2000c Spectrophotometer (Thermo Fisher Scientific). SSRT IV (Thermo Fisher Scientific) was used to reverse transcribe total RNAs into cDNA and QuantiTect SYBR Green RT-PCR Kit (QIAGEN) was used to prepare qPCR reaction mixtures with GAPDH as an endogenous control to measure the expression levels of DCST1-AS1 and Notch1 mRNA.
PureLink miRNA Isolation Kit (Thermo Fisher Scientific) was used to extract miRNAs from the aforementioned tissues and cells. Expression levels of mature miR-92a-3p were measured using All-in-One™ miRNA qRT-PCR Detection Kit (Genecopoeia) with U6 as endogenous control.
All PCR reactions were repeated 3 times and mean values were presented. Fold changes of gene expression were measured using 2−ΔΔCT method.
Ke J., Shen Z., Hu W., Li M., Shi Y., Xie Z, & Wu D. (2020). LncRNA DCST1-AS1 Was Upregulated in Endometrial Carcinoma and May Sponge miR-92a-3p to Upregulate Notch1. Cancer Management and Research, 12, 1221-1227.
+ Open protocol
+ Expand
2

RNA Isolation and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
To isolate RNA from HOG cultures, cells were washed with 1x PBS prior to RNA extraction. Trizol (Invitrogen) was used to extract RNA from the lysate, which was disrupted by cell resuspension and mixed with 2x denaturing solution. The RNA purification process involved acid-phenol: chloroform extraction, which removes most DNA, followed by the addition of 100% ethanol and filtering through a glass-fiber filter. The filter was then washed three times before RNA was eluted with warm sterile water (Ultrapure DEPC-Treated; Invitrogen) in a volume of 50–100 μL. The extracted RNA samples were used for cDNA synthesis using SSRT IV (ThermoFisher Scientific 4368814), and gene expression assays were quantified by qPCR using TaqMan assays. TNF-α, Caspase-3, and Caspase-8 (Applied BioSystems) were the genes of interest. Data was normalized to GAPDH mRNA as the endogenous reference, and quantitation of data was performed using the normalized cycle threshold method, and the data was converted to fold-change relative to the control group.
Liang S., Ti Y., Li X, & Zhou W. (2023). The Protective Role and Mechanism of Mild Therapeutic Hypothermia Protection on Brain Cells. Neuropsychiatric Disease and Treatment, 19, 1625-1631.
+ Open protocol
+ Expand
3

Circ_HECW2 and miR-93 Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was used for reverse transcription (RT) to prepare complementazry DNA (cDNA) samples using SSRT‐IV (18090010, Invitrogen) system. The synthesized cDNA was used as the template to evaluate Circ_HECW2 expression by quantitative reverse‐transcription polymerase chain reaction (RT‐qPCR) analysis using SYBR Green Master Mix (1725270; Bio‐Rad) with 18S rRNA as the internal control. Poly(A) was added to mature miRNAs using all‐in‐one miRNA qRT‐PCR Detection Kit (QP115; GeneCopoeia). The same kit was used to perform miRNA RTs and quantitative PCRs (qPCRs) to measure mature miR‐93 expression levels. The PCR reaction was carried out with Applied Biosystems AB7500 Real‐Time PCR system (Applied Biosystems) at the thermal cycle conditions of 95°C for 10 min and 40 cycles of 95°C for 15 s and 60°C for 1 min. Relative gene expression levels were calculated using the 2‐∆∆Ct method. The primers used for PCR were Circ_HECW2 forward 5′‐CCCACCACTTTGAACGCTAC‐3′ and reverse 5′‐GGCTGTCAATGCGTGCCT‐3′ and miR‐93 forward 5′‐AGGCCCAAAGT GCTGTTCGT‐3′ and reverse 5′‐GTGCAGGGTCCGAGGT‐3′.
Zuo J., Chen C., Zhang X., Wu J., Li C., Huang S., He P., Wa Q, & Zhang W. (2021). Circ_HECW2 regulates LPS‐induced apoptosis of chondrocytes via miR‐93 methylation. Immunity, Inflammation and Disease, 9(3), 943-949.
+ Open protocol
+ Expand
4

Reverse Transcription and qPCR for circCTNNA1 and miR-34a Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Reverse transcriptions (RTs) were performed to prepare cDNA samples with 3 μg total RNAs as template using SSRT IV (Invitrogen). Briefly, a 13 μl mixture of RNA samples, primer (0.5 μl) and 10 mM dNTP (1 μl) were was incubated at 65 °C for 5 min, followed by incubation on ice for 2 min. After that, 1 μl RNaseout, 1 μl DTT, 1 μl reverse transcriptase and 4 μl 5x buffer were added to prepare a 20 μl mixture, which was then incubated at 23 °C for 5 min, 50 °C for 15 min and 80 °C for 10 min. cDNA samples were used as template to perform qPCRs (1 μl cDNA for 20 μl reaction system). The expression of circCTNNA1 and miR-34a were determined with 18S rRNA and U6 as the internal control, respectively. The 2−ΔΔCt method was used to normalize Ct values.
Lu C., Song C., Han Q, & Jing X. (2022). CircCTNNA1 is Upregulated in Mantle Cell Lymphoma and Predicts Poor Survival by Sponging miR-34a to Increase Cell Proliferation. Mediterranean Journal of Hematology and Infectious Diseases, 14(1), e2022047.
+ Open protocol
+ Expand
5

Quantifying Gene Expression in T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted with Trizol, from sort-purified naive CD4+ T cells or naive CD4+ T cells cultured under Th0, Th17, iTreg, Th1, or Th2 cell conditions. The RNA was reverse transcribed using SSRTIV (Invitrogen; 18091050) according to the manufacturer’s protocol. The resultant cDNA served as the template for amplification of genes of interest and housekeeping gene (Actb), by QPCR using iQ SYBR Green Supermix (Bio-Rad Laboratories). Primers used can be found in Supplementary Table 2. Relative expression was calculated using the ΔCT method.
Carr T.M., Wheaton J.D., Houtz G.M, & Ciofani M. (2017). JunB promotes Th17 cell identity and restrains alternative CD4+ T-cell programs during inflammation. Nature Communications, 8, 301.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!