Viia 7 real time pcr apparatus

Manufactured by Thermo Fisher Scientific

Sourced in United States

The ViiA-7 Real-Time PCR apparatus is a laboratory instrument designed for the detection and quantification of nucleic acids through real-time polymerase chain reaction (PCR) analysis. The core function of the ViiA-7 is to amplify and measure the targeted DNA or RNA sequences in a sample over time, providing researchers with quantitative data on the presence and abundance of specific genetic targets.

Automatically generated - may contain errors

Lab products found in correlation

Rna ultrasense one step qrt pcr kit, by Thermo Fisher Scientific (4 mentions) Taqman pcr assay, by Thermo Fisher Scientific (3 mentions) Catcher plus kits, by Thermo Fisher Scientific (2 mentions) Taqman assay, by Thermo Fisher Scientific (1 mentions) Universal nuclease, by Thermo Fisher Scientific (1 mentions) Ncounter mouse inflammation v2 panel, by NanoString (1 mentions) Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Ncounter sprint, by NanoString (1 mentions) Nucleospin rna kit, by Macherey-Nagel (1 mentions) Nsolver software, by NanoString (1 mentions)

6 protocols using viia 7 real time pcr apparatus

Quantitative Real-Time PCR Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Relative mRNA expression was determined by TaqMan based real-time PCR, according to established protocols [39 (link)]. Adherent cells, seeded for a minimum of 24 hours (h) were lysed in situ, and RNA was isolated using Catcher PLUS kits (Life Technologies, Waltham, MA, USA). Real-time PCR was used to determine the abundance of each transcript relative to the endogenous control cyclophilin A (gene symbol PPIA) using the RNA Ultrasense One-step qRT-PCR kit (Life Technologies). Data was acquired using a ViiA-7 Real-Time PCR apparatus (Applied Biosystems Waltham, MA, USA/Life Technologies). Analysis was performed as 2^{(CT cyclophilin–CT marker)} and results were normalized to DMSO treated samples, as specified in figures. TaqMan assay (Life Technologies) ID numbers are listed in Table S2. Dose–response curves were prepared using an eight-point dilution scale ranging from 0.02–50 µM for apabetalone, and from 0.001–3.0 µM for JQ1.

Sarsons C.D., Gilham D., Tsujikawa L.M., Wasiak S., Fu L., Rakai B.D., Stotz S.C., Carestia A., Sweeney M, & Kulikowski E. (2023). Apabetalone, a Clinical-Stage, Selective BET Inhibitor, Opposes DUX4 Target Gene Expression in Primary Human FSHD Muscle Cells. Biomedicines, 11(10), 2683.

+ Open protocol

+ Expand

Quantifying Transcript Abundance in Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Following treatment, cells were harvested and transcripts were quantified via TaqMan real-time PCR as previously reported [43] (link). Briefly, mRNA was isolated using mRNA Catcher™ PLUS purification kits according to the manufacturer’s instructions (ThermoFisher). Taqman PCR assays were obtained from Applied Biosystems / Life Technologies. Real-time PCR was used to determine abundance of the transcript of interest relative to the endogenous control cyclophilin in a duplex reaction using the RNA Ultrasense One-step qRT-PCR kit (ThermoFisher). Data was acquired using a ViiA-7 Real-Time PCR apparatus (Applied Biosystems). The analysis was performed as 2^ ^(C_T^{cyclophilin – C}_T^{transcript of interest)} and results were normalized to DMSO treated samples.

Fu L., Gilham D., Stotz S.C., Sarsons C.D., Rakai B.D., Tsujikawa L.M., Wasiak S., Johansson J.O., Sweeney M., Wong N.C, & Kulikowski E. (2023). Dual mechanism: Epigenetic inhibitor apabetalone reduces SARS-CoV-2 Delta and Omicron variant spike binding and attenuates SARS-CoV-2 RNA induced inflammation. International Immunopharmacology, 117, 109929.

+ Open protocol

+ Expand

Adeno-associated Virus Production

Check if the same lab product or an alternative is used in the 5 most similar protocols

AAVs were produced as described (50 ,51 ). Briefly, AAV stocks were generated in HEK293T cells via PEI transfection using vector + serotype helper (pLTAAV). Cells were harvested 48h post-transfection, lysed via freeze/thaw cycling, treated with 100U/mL Universal Nuclease (Thermo) at 37°C for 30 minutes, and purified via centrifugation over an iodixanol density step gradient. Titers of viral stocks were determined via qRT-PCR analysis in conjunction with TaqMan reagents and a ViiA 7 Real-Time PCR apparatus (Applied Biosystems). qRT-PCR for viral titer used primers targeting the conserved ITR, using the following sequences: (F) GGAACCCCTAGTGATGGAGTT, (R) CGGCCTCAGTGAGCGA.

Snyder A.G., Hubbard N.W., Messmer M.N., Kofman S.B., Hagan C.E., Orozco S.L., Chiang K., Daniels B.P., Baker D, & Oberst A. (2019). Intratumoral activation of the necroptotic pathway components RIPK1 and RIPK3 potentiates anti-tumor immunity. Science immunology, 4(36), eaaw2004.

+ Open protocol

+ Expand

AAV-mediated inflammation gene profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

2 × 10⁶ B16.F10 cells were infected with 1 × 10¹¹ IFU of respective AAV for 10h. Total RNA was isolated using a Nucleospin RNA Kit (Macherey-Nagel) and run on an nCounter Sprint in conjunction with an nCounter Mouse Inflammation V2 Panel (Nanostring). Data were normalized and analyzed using nSolver software (Nanostring). For target gene validation, oligo(dT) random hexamers and SuperScript III Reverse Transcriptase (Life Technologies) were used to synthesize cDNA from the same total RNA samples used for Nanostring analysis. Fluorogenic quantitative reverse transcriptase PCR (qRT-PCR) analysis was performed using previously published oligonucleotide primer sequences using SYBR Green reagents and a ViiA 7 Real-Time PCR apparatus (Applied Biosystems). Cycle threshold (CT) values for target genes were normalized to CT values of the housekeeping gene Gapdh (ΔCT = CT_Target – CT_Gapdh), and subsequently normalized to baseline control values (ΔΔCT = ΔCT_Experimental – ΔCT_Control).

+ Open protocol

+ Expand

Apabetalone Modulates Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA was isolated from THP-1 cells and HUVEC cells, pretreated with apabetalone (5 or 20 uM) or vehicle (DMSO) for 1 h before stimulation with TNFα (10 ng/ml) in the presence of apabetalone or DMSO for 1 h (Additional file 1: Figure S1) or 4 h (all other experiments) (Catcher PLUS kits; Life Technologies). Taqman PCR assays were obtained from Applied Biosystems/Life Technologies. Real-time PCR was used to determine the abundance of the transcript relative to the endogenous control cyclophilin in the same sample using the RNA Ultrasense One-step qRT-PCR kit (Life Technologies). Data was acquired using a ViiA-7 Real-Time PCR apparatus (Applied Biosystems). Analysis was performed as 2^ (CT cyclophilin – CT marker) and results were normalized to DMSO treated samples.

Tsujikawa L.M., Fu L., Das S., Halliday C., Rakai B.D., Stotz S.C., Sarsons C.D., Gilham D., Daze E., Wasiak S., Studer D., Rinker K.D., Sweeney M., Johansson J.O., Wong N.C, & Kulikowski E. (2019). Apabetalone (RVX-208) reduces vascular inflammation in vitro and in CVD patients by a BET-dependent epigenetic mechanism. Clinical Epigenetics, 11, 102.

+ Open protocol

+ Expand

BETi Compound Effects on Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were treated with BETi compounds or vehicle (DMSO) in complete medium for up to 96 hours.
Following treatment, cells were harvested, and transcripts quantified via TaqMan real-time PCR as previously described 30, (link)31 (link) . Briefly, mRNA was isolated using mRNA Catcher™ PLUS purification kits according to the manufacturer's instructions (Thermo Fisher). Taqman PCR assays were obtained from Applied Biosystems / Life Technologies. Real-time PCR was used to determine abundance of the transcript of interest relative to the endogenous reference gene, cyclophilin in a duplex reaction using the RNA Ultrasense One-step qRT-PCR kit (Thermo Fisher). Data was acquired using a ViiA-7 Real-Time PCR apparatus (Applied Biosystems). The analysis was performed as 2^ (C T cyclophilin -C T transcript of interest) and results
were normalized to DMSO treated samples.

Gilham D., Smith A.L., Fu L., Moore D., Muralidharan A., Reid S.P., Stotz S.C., Johansson J.O., Sweeney M., Wong N.C., Kulikowski E., & El‐Gamal D. (2021). Bromodomain and extraterminal protein inhibitor, apabetalone (RVX-208), reduces ACE2 expression and attenuates SARS-CoV-2 infection in vitro.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!