The CRISPR-Cas 9 system was used to knockout MEK1 (MAP2K1) in the CT26 cells. Guide RNA sequences were chosen from the GeCKov2 library pool (MGLibA_30220, MGLibA_30222, MGLibB_30213) (26 (link)). Vectors were created by cloning the guide RNAs into the lentiCRISPR v2 one vector system backbone (Addgene, cat. #52961). 1×106 CT26 cells were plated in T25 flasks in antibiotic-free media 24 hours prior to transfection. Cells were then transiently transfected with the vectors using lipofectamine (Thermo Fisher Scientific, cat. # L3000008) according to the manufacturer’s instructions. Post transfection, CT26 cells were recovered for 24 hours after which they were selected using puromycin (Sigma-Aldrich, cat. #P8833) at 40ug/ml for 48 hours. Post selection, the cells were single-cell diluted and individual colonies were sequenced at the locus to identify clones with insertions/deletions at the cut site. Several clones were then analyzed by western blot to verify complete knockout of MEK1. The clone selected for in vivo experiments was generated using the guide sequence MGLibA_30222.
Lenticrispr v2 one vector system
Manufactured by Addgene
The LentiCRISPR v2 is a one-vector system for CRISPR-Cas9 gene editing. It contains the Cas9 endonuclease and the guide RNA (gRNA) expression cassette in a single lentiviral vector.
Automatically generated - may contain errors
2 protocols using lenticrispr v2 one vector system
1
CRISPR-Cas9 Knockout of MEK1 in CT26 Cells
2
CRISPR/Cas9 Knockout of Metabolic Genes in PATC Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sgRNAs targeting SOD2 / GNPAT / AGPS / FAR1/ UQCC3 were designed using CRISPick website software (https://portals.broadinstitute.org/gppx/crispick/public ) supported by BROAD Institute. The sequences are SOD2, ACAAACCTCAGCCCTAACGG; GNPAT, ATGGCTAAAAGGCTTAACCC; AGPS, TTTGTTCAAATACGGTCAGT; FAR1, AGCACTAATCCTTTCCACTG; UQCC3, #1 CTCCCGGGGTCACGATAACG, #2 GCGGAAGCAGGAAATGCTAA. The sgRNAs were individually inserted into LentiCRISPR v2 one vector system (Addgene, Plasmid #52961) and transfected in HEK-293 cells (CRL-1573TM) for 48 hr. The culturing medium was isolated and filtered (0.22 μm pore size, MilliporeSigma™ SCGP00525). After ultracentrifuge at 25,000 g for 2 hr, virus pellets were suspended by PBS and infected into PATC lines. The stable CRISPR/Cas9 knockout PATC lines targeting indicated genes were generated after puromycin (1 mg/mL, Invivogen, # ant-pr-1) selection. Western blotting was detected for the loss of proteins.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!