Mir 25 mimic

Manufactured by GenePharma

Sourced in China

The MiR-25 mimic is a laboratory reagent designed to mimic the function of the microRNA miR-25. MicroRNAs are small, non-coding RNA molecules that play a role in gene expression regulation. The MiR-25 mimic can be used in research applications to study the biological functions of miR-25 in various cellular processes.

Automatically generated - may contain errors

Lab products found in correlation

Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions) Npc1 sirna, by Qiagen (1 mentions) Mimic control, by GenePharma (1 mentions) Control sirna, by GenePharma (1 mentions) Hiperfect transfection reagent, by Qiagen (1 mentions) Pcdna pten, by GenePharma (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions) Triton x 100, by Beyotime (1 mentions) Bca protein assay kit, by Biosharp (1 mentions) Paraformaldehyde (pfa), by Sinopharm (1 mentions) Hoechst 33258, by Beyotime (1 mentions) Glycerin, by Sinopharm (1 mentions) Radio immunoprecipitation assay ripa lysis buffer, by Beyotime (1 mentions) Quikchange site directed mutagenesis kit, by Agilent Technologies (1 mentions) Dharmafect 1 reagent, by GE Healthcare (1 mentions) Streptomycin, by Thermo Fisher Scientific (1 mentions) Penicillin, by Thermo Fisher Scientific (1 mentions) Smooth muscle cell growth supplement, by Thermo Fisher Scientific (1 mentions) Human vsmcs, by American Type Culture Collection (1 mentions)

Spelling variants of this product

MiR-25-3p mimic (4 citations) MiR-mimics (3 citations) MiR-25-3p mimics/inhibitors (2 citations)

4 protocols using mir 25 mimic

MiR-25 Regulation of NPC1 in THP-1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

THP-1 cells (1.5×10⁶) were seeded in each well of 6-well plates and differentiated with PMA. Then, 50 nM MiR-25 mimic, control mimic, miR-25 inhibitor, inhibitor control, NPC1 siRNA or control siRNA was transfected into cells by using HiPerFect Transfection Reagent (Qiagen, 301705) according to the reagent instructions. Cells were transfected 48 h before collection or further experiments.
MiR-25 mimic (5′-CAUUGCACUUGUCUCGGUCUCUGA-3′), control mimic (5′-UUCUCCGAACGUGUCACGUTT-3′), miR-25 inhibitor (5′-UCAGACCGAGACAAGUGCAAUG-3′), inhibitor control (5′-CAGUACUUUUGUGUAGUACAA-3′), NPC1 siRNA (5′-GAGGUACAAUUGCGAAUAUTT-3′), NFKBIZ siRNA (5′-GCCCGAUUCGUUGUCUGAUTT-3′) and control siRNA (5′-UUCUCCGAACGUGUCACGUTT-3′) were purchased from GenePharma.

Dong W., Wang G., Feng J., Li P., Wang R., Lu H., Lu W., Wang C., Wang X., Chen H., Xiang Y, & Tan C. (2022). MiR-25 blunts autophagy and promotes the survival of Mycobacterium tuberculosis by regulating NPC1. iScience, 25(5), 104279.

+ Open protocol

+ Expand

LPS-Induced H9C2 Cardiomyocyte Modeling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cardiomyocytes (H9C2 cell line) were purchased from Cell Bank of Chinese Academy of Sciences. Cells were cultured in DMEM supplemented with 1.5 g/l NaHCO₃, 10% FBS (Gibco, Invitrogen, U.S.A.), 1% glutamine, and 1% penicillin-streptomycin in 5% CO₂ incubator under 37°C. H9C2 cells were treated with LPS for 24 h. MiR-25 mimic, miR-25 inhibitor, and pcDNA-PTEN were synthesized by GenePharma (Shanghai, China). Lipofectamine 2000 (Invitrogen) was used to perform cell transfection according to the manufacturer’s instructions.

Yao Y., Sun F, & Lei M. (2018). miR-25 inhibits sepsis-induced cardiomyocyte apoptosis by targetting PTEN. Bioscience Reports, 38(2), BSR20171511.

+ Open protocol

+ Expand

In Vitro Osteoclast Differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ti particles were obtained from ThermoFisher Scientific (purity 93%, diameter < 20 μm, USA). Phosphate-buffered saline (PBS) was purchased from Hyclone (USA). miR-25 mimics and miR-25 negative control (NC) (sequence: sense, AGUCUGGCUCUGUUCACGUUAC; antisense, GUAACGUGAACAGAGCVAGACU) were synthesized by GenePharm (Shanghai, China). Lipofectamine™ RNAiMAX (Invitrogen 2149333) was obtained from ThermoFisher Scientific. Fura-2 AM (S1052) was purchased from Beyotime Biotechnology (China). The tartrate-resistant acid phosphatase (TRAP) staining kit (387A) was obtained from Sigma-Aldrich (USA). The reverse transcription (RT) kit (MR101-01/02) and qPCR reaction kit (Q711-02) were obtained from Vazyme Biotech Co., Ltd (Nanjing, China). Paraformaldehyde and glycerin were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Triton X-100, Hoechst 33258, radioimmunoprecipitation assay (RIPA) lysis buffer and polymethylsulfonyl fluoride (PMSF) were purchased from Beyotime Biotechnology. The BCA protein assay kit (BL521A) was obtained from BIOSHARP (USA). The supplier information for primer sequences is presented in Additional file 1: Table S1, and that for antibodies is included in Additional file 2: Table S2.

Hu W., Yu Y., Sun Y., Yuan F, & Zhao F. (2022). MiR-25 overexpression inhibits titanium particle-induced osteoclast differentiation via down-regulation of mitochondrial calcium uniporter in vitro. Journal of Orthopaedic Surgery and Research, 17, 133.

+ Open protocol

+ Expand

miR-25 Regulation of CDK6 in VSMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

All experiments were approved by the Clinical Research Ethics Committee of The Fourth Affiliated Hospital, Harbin Medical University (Harbin, China).
Vectors and cell culture. The pcDNA-CDK6 vector was purchased from Sigma-Aldrich (Oakville, ON, Canada). The CDK6 3'UTR sequence with the binding site for miR-25 was cloned into the pMIR-REPORT luciferase construct (Ambion Life Technologies, Carlsbad, CA, USA). The mutant construct of CDK6 3'UTR was generated using the QuikChange Site-Directed Mutagenesis kit (Agilent Technologies, Inc., Santa Clara, CA, USA). The reagents for cell culture (fetal bovine serum, penicillin and streptomycin) were purchased from Gibco Life Technologies (Carlsbad, CA, USA). Human VSMCs were obtained from the American Type Culture Collection (Manassas, VA, USA) and cultured in the medium 231 supplemented with smooth muscle cell growth supplement (Gibco Life Technologies) at 37˚C in a humidified atmosphere of 95% air and 5% CO 2 .
Cell transfection. The miR-25 mimics and the control were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China) and transfected into the cells to a final oligonucleotide concentration of 20 nmol/l. All cell transfections were introduced using DharmaFECT 1 reagent (GE Healthcare Biosciences, Pittsburgh, PA, USA) according to the manufacturer's instructions.

Qi L., Zhi J., Zhang T., Cao X., Sun L., Xu Y, & Li X. (2015). Inhibition of microRNA-25 by tumor necrosis factor α is critical in the modulation of vascular smooth muscle cell proliferation. Molecular medicine reports, 11(6).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!