Sybr green pcr master mix 2x

RNA was extracted from NB cells using EuroGold Trifast (EuroClone). cDNA was generated using Quantitec Reverse Transcription Kit (Qiagen), according to manufacturer's protocol. Quantitative analysis was performed using SYBR Green 2X PCR Master Mix (Applied Biosystem). Each sample was run in triplicate and normalized to the expression of housekeeping beta-glucoronidase (GUSb) gene as previously described [6 (link)]. Primers are presented in Supplementary Table S1.

RNA was extracted from MCF10-MycER and Tet-21/N cells using EuroGold Trifast (EuroClone, Milan, Italy). cDNA was generated using Quantitec Reverse Transcription Kit (Qiagen, Hilden, Germany), according to manufacturer’s protocol. Quantitative analysis was performed using SYBR Green 2X PCR Master Mix (Applied Biosystem, Forster City, CA, USA). Each sample was run in triplicate and normalized to the expression of housekeeping beta-glucoronidase (GUS) gene as previously described.^{46 (link)} The primers used in qPCR are: AKAP1, TTCTCTGCCGATGACATCCT and CATTGACCTGGTTGACC ACA; GUS GGAATTTTGCCGATTTCATGA and CCGAGTGAAGATCCCCTTTTT.

RNA was extracted from MCF10A-AsiSIER cells using EuroGold Trifast (EuroClone). cDNA was generated using Quantitec Reverse Transcription Kit (Qiagen), according to manufacturer's protocol. Quantitative analysis was performed using SYBR Green 2X PCR Master Mix (Applied Biosystem). Each sample was run in triplicate and normalized to the expression of housekeeping beta-glucoronidase (GUS) gene as previously described [44 (link)]. Primers are presented in Supplementary Table S2.

EpiQuik Hydroxymethylated DNA Immunoprecipitation Kit (hMeDIP, Epigentek) was used for immunoprecipitation of 5hmC in 11 samples (corresponding to 5 brain samples, 5 GBM samples and LN-229 GBM cell line), according to supplier’s protocol. Input, non-specific IgG and 5hmC-enriched fractions were amplified by Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) in a StepOnePlus^TM Real-Time PCR machine (Applied Biosystems) with SYBR Green 2X PCR Master Mix (Applied Biosystems, 4309155) and oligonucleotides for the CpGs in the promoter of KMT5B listed in Supplementary Table 1. Relative 5hmC enrichment was calculated as a Fold Change relative to Input Ct Mean.

RNA isolation and cDNA synthesis were performed as previously described [53 (link)]. The cDNA templates were diluted 1:40 and added to PCR reactions containing GoTaq Master Mix (Promega, Madison WI) and 10 μM each of the appropriate forward and reverse primers (S1 Table). Samples were initially denatured for 5 min at 95°C followed by 30 cycles of PCR amplification (95°C for 15 sec, 60°C for 30 sec, 72°C for 1 min) and a final extension for 10 min at 72°C. PCR products were visualized on a 1.5% agarose gel containing 0.1% ethidium bromide. PCR reactions were repeated using at least three different prenatal retinal neurosphere cultures to ensure reproducibility. RT-qPCR (40 cycles) was also performed as described using primer pairs that spanned at least one intron, SYBR Green 2X PCR Master Mix (Applied Biosystems, Foster City CA), and the ABI 7500 PCR System (Applied Biosystems, Foster City, CA) [53 (link)].