All mice were 8-week-old males. IDO1 K.O. mice, of a C57BL/6J background were obtained from Jackson Laboratory (Bar Harbor, ME). Wild -type C57BL/6J mice were obtained from SHIMIZU Laboratory Supplies Co., Ltd. (Kyoto, Japan). Animals were housed in the Kyoto University School of Medicine animal facilities under specific pathogen-free conditions and were maintained on a 12-hour light/dark cycle (lights on at 8:00 a.m.) at 25 °C. Mice had free access to food and water. The protocols for animal experiments were approved by the Animal Experimentation Committee of the Graduate School of Medicine, Kyoto University, and all experiments were performed in accordance with approved guidelines and regulations.
Ido1 ko mice
Manufactured by Jackson ImmunoResearch
Sourced in United States
IDO1 KO mice are a genetically engineered mouse model that lacks the Indoleamine 2,3-dioxygenase 1 (IDO1) gene. IDO1 is an enzyme involved in the metabolism of the amino acid tryptophan. The IDO1 KO mouse model is used in research to study the role of IDO1 in various biological processes.
Automatically generated - may contain errors
Lab products found in correlation
C57bl 6j wt mice, by Jackson ImmunoResearch (2 mentions)
C57bl 6j, by Jackson ImmunoResearch (1 mentions)
Wt c57bl 6n mice, by Charles River Laboratories (1 mentions)
Wild type c57bl 6j, by Jackson ImmunoResearch (1 mentions)
Gotaq kit, by Promega (1 mentions)
Nucleospin tissue extraction kit, by Macherey-Nagel (1 mentions)
7 protocols using ido1 ko mice
1
Characterizing IDO1 Knockout Mice
2
Characterization of IDO-deficient Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All mice used in experiments were 8–10-week-old females. IDO2 KO mice on a C57BL/6N background were obtained from the Knockout Mouse Project (KOMP, CA, USA). Mice that were homozygous null (IDO2 KO) by targeted disruption of the IDO2 gene were selected from the offspring of heterozygous-homozygous mating based on PCR of tail DNA for genotyping. IDO1 KO mice on a C57BL/6 background were obtained from Jackson Laboratory (Bar Harbor, ME, USA). We purchased WT C57BL/6N mice from Charles River Laboratories (Yokohama, Japan). Mice were housed in the animal facilities of Fujita Health University Graduate School of Medicine under specific pathogen-free conditions, maintained at 25 °C on a standard 12-h light/dark cycle (lights on at 08:00) and with free access to food and water. The protocol for all animal experiments was approved by the Animal Experimentation Committee of Fujita Health University Graduate School of Medicine (AP19067, approved on 20 May 2019). Procedures involving mice and their care conformed to international guidelines, as described in the Principles of Laboratory Animal Care (National Institutes of Health publication 85–23, revised in 1985).
3
Ido1 Knockout Mouse Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6J (wild-type) or Ido1KO mice (The Jackson Laboratory, Bar Harbor, ME, USA) were used to establish breeding colonies to supply male mice for experiments. Mice were housed on a reversed 12 h light-dark cycle with ab lib access to food and water. Mice were individually housed at least 1 week prior to experiments. Mice were 14–15 weeks of age at the time of treatment. All animal procedures were approved by the Institutional Animal Care and Use Committee and performed in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council).
4
Comparative Study of WT and IDO1 KO Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6J mice (WT) and Ido1 KO mice (stock#005867, C57BL/6J background) were purchased from the Jackson Laboratory (Bar Harbor, ME) and then bred in the Laboratory Research Animal Center of University of Kansas Medical Center. Mice were maintained in a specific pathogen-free facility on a 12-hour light/12-hour dark cycle. Littermates were randomly assigned to experimental groups.
5
Genotyping of Ahr Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6 mice were bred in the animal facility of the Ludwig Institute for Cancer Research, Brussels, Belgium. C57BL/6 Ahr-KO (Ahr knock-out) mice were obtained from D. Togbe (CNRS UMR7355, Orl’eans, France). DBA/2 Ahr-KO mice were generated from backcrossing C57BL/6 Ahr-KO mice with DBA/2 mice bred in the animal facility of de Duve Institute (Brussels, Belgium). Ido1-KO mice were purchased from Jackson Laboratory. Mice were used for ex vivo experiments at 8–12 weeks of age. Mice were bred and maintained under specific pathogen-free conditions. Genotyping was performed by PCR. DNA was extracted from mice ear tissue using the Nucleospin Tissue extraction kit (740952.50, Macherey-Nagel). Genotyping was performed by PCR using the Gotaq kit (#M7845, Promega). Primers were purchased from Eurogentec. Gene: Ahr forward GGCTAGCGTGCGGGTTTCTC , reverse CTCCGTGTCCCCTAAAGCTTCA , Neomycin resistance-gene forward CGGGAGCGGCGATACCGTAAAGC , reverse GAAGCGGGAAGGGACTGGCTGCTA . PCR products were separated on a 1 % agarose gel.
6
Comparative Study of WT and IDO1 KO Mice
7
Murine Model of IDO1 Knockout
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Male C57BL/6 mice (6-8 weeks of age) were purchased from the Experimental Animal Center of Southern Medical University (Guangzhou, China). The IDO1 KO mice were obtained from the Jackson Laboratory (Bar Harbor, ME, USA) and WT littermates were produced by heterozygous mating. The results of gene identi cation of IDO1 -/-mice were presented in the Supplementary Fig. S1. Animals were maintained in speci c pathogen-free facilities with a temperature of (22 ± 1℃) and a 12h light/12h dark cycle and were offered free access to standard food and water. All animal procedures in this study were approved by the Institutional Animal Care and Use Committee of Southern Medical University (Permit Number: 00197090).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!