Lightcycler software version 4

The primers and the probe used were those for the 16S rRNA sequence of the O. tsutsugamushi Gilliam strain (accession no. L36222) as described previously^{9 (link)}. For the probe, 6-carboxyfluorescein (FAM) was attached to the 5′ end, and black hole quencher 1 (BHQ-1) was attached to the 3′ end (Fig. 1).Figure 1

Diagram indicating the primer positions in Orientia tsutsugamushi. (a) 16S rRNA gene. (b) 47-kDa protein gene. (c) 56-kDa protein gene.

The standard curve was generated with tenfold serial dilutions of 10⁸ copies/μL of plasmid DNA prepared by cloning partial DNA fragments of the O. tsutsugamushi 16S rRNA gene. A total volume of 20 μL of reaction solution was prepared for Q-PCR by mixing 5 μL of DNA, 1 μL (5 pmol/μL) of each primer, 1 μL (2 pmol/μL) of the probe, 4 μL of 5× master mix (reaction buffer, Fast Start Taq DNA polymerase, MgCl₂, and deoxynucleoside triphosphates (with dUTP instead of dTTP), and sterilized triple-distilled water. For the PCR, an initialization step was conducted at 90 °C for 10 min followed by 45 cycles of 2-step reactions conducted for 10 s at 95 °C and for 30 s at 60 °C; final cooling was subsequently conducted at 40 °C for 30 s. The Q-PCR results were analyzed with the Light Cycler software, version 4.0 (Roche, Basel, Switzerland). Cases with a crossing-point value less than 38 were considered positive, as described previously^{9 (link)}.

Pooled samples from at least three samples were used for the total RNA extraction. cDNA was synthesized from 5 μg of the total RNA using High Capacity cDNA reverse transcription kit (Applied Biosystems, Poland). cDNA was added to 5 μl of SYBR Green PCR mix (A&A Biotechnology, Gdynia, Poland) and 0.5 μl of each primer (0.5 μm) in triplicate. Polymerase chain reaction (PCR) was carried out with the use of specific primers for glycosyltransferase gene (forward, GTCCTCTTGGTGACATTTCCCACAC and reverse, TGAGGAAATGCCACCACAGGTACAC). Amplification and detection were performed using LightCycler 2.0 instrument and lightcycler software version 4.0 (Roche, Warszawa, Poland).

Real-time PCR was performed with the Light Cycler 2.0 (Roche) using the Fast Start DNA Master SYBR Green I Kit (Roche). For verification of the correct amplification product, PCR products were analyzed on a 2% agarose gel stained with ethidium bromide. The sequences of the primers were designed as follows: for β-actin, 5′-GACTATGACTTAGTTGCGTTA-3′ and 5′-GCCTTCATACATCTCAAGTTG-3′, for snail, 5′-GGCTCCTTCGTCCTTCT-3′ and 5′-GGCTGAGGTATTCCTTGTT-3′, for twist1, 5′-CGGGAGTCCGCAGTCTTA-3′ and 5′-CTGGTAGAGGAAGTCGATGT-3′, for c-myc, 5′- GCTTTATCTAACTCGCTGTAGTAAT-3′ and 5′- GCTGCTATGGGCAAAGTTTC-3′. Primers of MMP7 (P310408) and MM9 (P323207) were purchased from Bioneer. PCR was conducted at 95 °C for 10 min, followed by 45 cycles of 95 °C for 15 seconds, 60 °C for 5 seconds, and 72 °C for 7 seconds. Melt curve analysis was performed to confirm that a single product was present. Negative controls without template were included in each run. Data were analyzed using Light Cycler software version 4.0 (Roche, Switzerland). The 2^ΔΔCt method was used for analysis of relative gene expression.

RT-PCR analysis for gene expression and the quantitative real-time PCR (qPCR) were performed by an intercalator-based method (Roche Applied Science, Mannheim, Germany), as described previously^{15 (link),19 (link)}. The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as an internal control. Experiments were performed in duplicate and the results were analyzed by software (LightCycler Software Version 4.0, Roche Applied Science). Expression was detected using the relevant primers for the five selected genes detected by gene microarrays: h-GAPDH forward: 5′-AGG TCA TCC CTG AGC TGA ACG G-3′, reverse: 5′-CGC CTG CTT CAC CAC CTT CTT G-3′; h-BMP8B forward: 5′-CTT TCG TGG TCA CTT TCT TC-3′, reverse: 5′-TGG ACG TCA TCA AAG ATC C-3′; h-CCR6 forward: 5′-GGG AAT CAA TGA ATT TCA GC-3′, reverse: 5′-CAA TCG GTA CAA ATA GCC TG-3′; h-HOXA9 forward: 5′-ATT GGA GGA AAT GAA TGC TG-3′, reverse: 5′-GAA ACC CCA GAT TCA TCA AG-3′; h-NANOG forward: 5′-CCA GAA CCA GAG AAT GAA ATC-3′, reverse: 5′-TGG TGG TAG GAA GAG TAA AG-3′; h-S100A8 forward: 5′-GTA TAT CAG GAA AAA GGG TGC-3′, reverse: 5′-TAC TCT TTG TGG CTT TCT TC-3’.

A duplex qPCR assay with minor modifications for the LightCycler real-time machine (Roche Diagnostics) targeting the msp1β gene of A. marginale and the groEL gene of A. centrale, was used to detect Anaplasma spp. in genomic DNA samples as previously described [18 (link)]. DNA extracted from the A. centrale vaccine strain (Onderstepoort Biological Products, Pretoria, South Africa) or field sample 9410 (confirmed to be infected with A. centrale by amplification and sequence analysis of the groEL, msp2 and 16S rRNA genes [18 (link)]) were used as positive controls. Field samples C14 or C57 (obtained from cattle in the Mnisi Community area) were used as positive controls for A. marginale, and molecular grade water as a negative control. To determine A. centrale loads, DNA was extracted from 10-fold serial dilutions of vaccine prepared in uninfected bovine blood. The data were analysed using LightCycler Software version 4.0. (Roche Diagnostics). The linear range of detection and assay efficiency of selected variants were determined as previously described [18 (link)].

The human metastatic-related gene primers are listed in the Supplementary Table S1. All oligo primers were synthesized by Genomics BioSci and Tech (Taipei, Taiwan). A LightCycler thermocycler (Roche Molecular Biochemicals, Mannheim, Germany) was used for Q-PCR analysis. One microliter of the sample and master-mix was first denatured for 10 min at 95°C and then incubated during 40 cycles (denaturation at 95°C for 5 s; annealing at 60°C for 5 s; elongation at 72°C for 10 s) to detect fluorescent intensity. All of the PCR samples underwent melting curve analysis for non-specific PCR product detection. The gene expression results from the Q-PCR analysis were normalized with human β-glucuronidase (GUS) expression as an internal control using the built-in Roche LightCycler Software, Version 4.