The largest database of trusted experimental protocols

Nrf2 transcription factor assay kit colorimetric

Manufactured by Abcam

The Nrf2 transcription factor assay kit (colorimetric) is a laboratory tool designed to detect and quantify the activity of the Nrf2 transcription factor in cell and tissue samples. The kit utilizes a colorimetric detection method to measure the DNA-binding activity of Nrf2, which is a key regulator of the cellular antioxidant response.

Automatically generated - may contain errors

3 protocols using nrf2 transcription factor assay kit colorimetric

1

Nrf2 Activation and Oxidative Stress Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Glutathione/Glutathione disulfide (GSH/GSSG) ratio was determined using the GSH/GSSG ratio detection assay kit (fluorometric - green) (#ab205811 from Abcam) and the transcriptional activity of Nrf2 was determined using the Nrf2 transcription factor assay kit (colorimetric) (#ab207223 from Abcam). Methylglyoxal (MG) formation was determined using the methylglyoxal assay kit (#ab241006 from Abcam) and 3-nitrotyrosine formation was measured using the 3-nitrotyrosine ELISA kit (#ab116691 from Abcam) according to the manufacturer’s instructions.
+ Open protocol
+ Expand
2

Antibody-Based Stem Cell Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies recognizing NANOG (D73G4), SOX2 (D6D9), KLF4 (D1F2), HO1 (D60G11), Vimentin (D21H3) and Keap1 (D6B12) were obtained from Cell Signaling Technology (Danvers, MA, USA). E-cadherin (610404) was obtained from BD Biosciences (San Jose, CA, USA). Nrf2 (ab-89443), SLUG (ab-27568), SNAIL (ab-53519) and Bach1 (ab-115210) were purchased from Abcam, (Burlingame, CA, USA) and NQO1 (sc-32793), BAX (sc-7480), BCL2 (sc-7382) were obtained from Santa Cruz Biotechnology (Dallas, TX, USA). Nrf2-targeting shRNA lentiviral particles (sc-37030-v) were obtained from Santa Cruz Biotechnology (CA, USA). Bovine serum albumin (BSA), fibroblast growth factor (FGF) and epidermal growth factor (EGF) were purchased from Sigma-Aldrich (St. Louis, MO, USA). ALDEFLUOR Kit (01700) was obtained from STEM CELL technologies (Vancouver, Canada). Nrf2 Transcription Factor Assay Kit (Colorimetric) (ab207223) was obtained from Abcam. Annexin-V-FITC (556419) was obtained from BD Biosciences (San Jose, CA, USA).
+ Open protocol
+ Expand
3

Nrf2-ARE Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The binding of transcription factor NF-E2 p45-related factor 2 (Nrf2) with the antioxidant response element (ARE) was assessed with an ELISA assay kit (Nrf2 Transcription Factor Assay Kit, Colorimetric, Abcam). Five micrograms of left ventricle protein was incubated with oligonucleotide ARE consensus binding site (5′ GTCACAGTGACTCAGCAGAATCTG–3′). Detection was performed with specific antibodies and measured by colorimetric (HRP catalyzed reaction) at 450 nm in a hybrid multimode reader (Sinergy H1, Biotek-Agilent, Santa Clara, CA, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!