Longamp taq buffer

To determine copy numbers of HIV proviral DNA, a nested PCR method was used [26 (link)]. The first PCR was performed using a forward primer that targeted genomic alu sequences randomly located near integrated proviruses (0.2 μM) and an HIV-specific gag reverse primer (1.2μM). Other PCR conditions were 200 μM of each dNTP, 1X LongAmp taq buffer (NEB), 5 units of LongAmp taq DNA polymerase (NEB) and 50 ng of DNA sample extracted from infected cells in a 50μl final reaction volume. Amplification was performed using the following thermocycler program: initial activation heating 94 ⁰C for two min, followed by 20 cycles of denaturation at 94 ⁰C for 30 sec, annealing at 50 ⁰C for 30 sec and extension at 65 ⁰C for three min and a final extension reaction at 65 ⁰C for ten minutes. The PCR product is diluted 20-fold and five μl of the diluted PCR product is used as an input material for the second PCR reaction, which is performed using LRT forward and reverse primers and probe using the Rotor Gene Probe PCR kit (Qiagen) as described above. Proviral copy numbers were determined using the J-lat cell integration standard as described above. Genomic copy numbers were determined using the RPP30 qPCR measurement described above using the same amount of input total DNA sample used to measure proviral copy numbers.

The extracted DNA was then subjected to amplification in a Simpli Amp Thermocycler (Applied Biosystems, Waltham, MA, USA).
We evaluated one ribosomal marker of full length 16 S rRNA gene. The DNA containing the target bacteria was amplified to target the 16SrRNA gene using the 16–27 F (TTTCTGTTGGTGCTGATATTGCAGAGTTTGATCMTGGCTCAG) and 16 S-1492R (ACTTGCCTGTCGCTCTATCTTCGGTTACCTTGTTACGACTT) primer sets. All the primers contained the Oxford Nanopore tag which is an overhang that allows barcoding the sample during the second barcoding PCR. The mixture for the full length 16SrRNA gene (25μL total volume) contained 10ng of DNA template, 5X LongAmp Taq buffer, 0.3mM dNTPs, 0.4 μM of each primer and 0.5 units of LongAmp Taq DNA Polymerase (New England BioLabs). The PCR conditions were: denaturization of 30 s at 98^oC followed by 35 cycles of 15 s at 98^oC, 15 s at 51^oC, 45 s at 72^oC and a final step of 7 min at 72 ^oC and then hold at 4⁰C. The amplicons were then run on a 2% gel stained with 1 μg/mL of ethidium bromide and viewed under U.V light in a viewer box (Vilber E-box, Vilber, Deutschland GmbH. Wielandstrasse 2, Germany).

For PCR, amplifications up to 3 kbp were performed as previously described [18 (link)], with the exception of the elongation time, which was 1 min per 1 kbp of amplicon. For amplicons longer than 3 kbp, each reaction was built as follows: 3.75 μL of 2 mM dNTPs, 1 μL of each 100 ng/μL forward and reverse primers, 1 μL of 100 ng/μL template, 12.25 μL of H₂O, 5 μL of 5X LongAmp Taq buffer (New England BioLabs, Massachusetts, US), and 1 μL LongAmp Taq (New England BioLabs). For those amplicons, the elongation time was 50 s per 1 kb of amplicon. New PCR primers were designed manually and verified with Oligoanalyser 3.1 from Integrated DNA Technologies (IDT, http://www.idtdna.com/calc/analyzer). The PCR assays were performed at least twice, and appropriate positive and negative controls were included with each assay. The PCR primers are listed in Additional file 3.