Liver lobes collected for qPCR analysis were homogenized in 3 mL of denaturing solution (4 M guanidine thiocyanate; 25 mM sodium citrate pH 7; 0.5% w/v N-lauroylsarcosine and 0.7% v/v β-mercaptoethanol in DEPC-treated water). Total RNA was extracted from liver homogenates using the Qiagen RNA extraction kit, according to the manufacturer’s instructions. The concentration of RNA in each sample was assessed by measurement of absorbance at 260 nm on a NanoDrop 2000 spectrophotometer. Complementary DNA (cDNA) was synthesized from 1 μg of RNA using the NZYTech First-Strand cDNA synthesis kit, according to the manufacturer’s instructions. The cDNA was synthesized in a Biometra Personal thermocycler employing the following parameters: 25 °C for 10 min, 55 °C for 30 min and 85 °C for 5 min. The qPCR reaction was performed in a total volume of 20 μL in an ABI Prism 7500 Fast system (Applied Biosystems) using the SYBR® Green Real-Time PCR Master Mix (BioRad). Parasite load was quantified using primers specific to Pb 18 S rRNA (forward/reverse: AAGCATTAAATAAAGCGAATACATCCTTAC/ GGAGATTGGTTTTGACGTTTATGTG). Mouse housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (Hprt) expression was used for normalization (forward/reverse: TTTGCTGACCTGCTGGATTAC/ CAAGACATTCTTTCCAGTTAAAGTTG). Analysis of qPCR data was performed using the delta-delta relative quantification method.
Personal thermocycler
Manufactured by Analytik Jena
Sourced in Germany
The Personal Thermocycler is a compact and versatile instrument designed for performing polymerase chain reaction (PCR) experiments. It is capable of accurately controlling and cycling the temperature of samples to enable DNA amplification and other temperature-dependent biochemical reactions.
Automatically generated - may contain errors
Lab products found in correlation
First strand cdna synthesis kit, by NZYTech (1 mentions)
Abi prism 7500 fast system, by Thermo Fisher Scientific (1 mentions)
Rna extraction kit, by Qiagen (1 mentions)
Sybr green real time pcr master mix, by Bio-Rad (1 mentions)
1 kb dna molecular ladder, by Meridian Bioscience (1 mentions)
Qiaquick pcr puri cation kit, by Qiagen (1 mentions)
Biotaq dna polymerase, by Meridian Bioscience (1 mentions)
3 protocols using personal thermocycler
1
Quantifying Liver Parasite Load via qPCR
2
Yeast Cytoplasmic DNA Loss Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To force the yeast cells to lose linear cytoplasmic DNA, strains were cultivated on YPD medium without NaCl at 30 °C, with shaking at 160 rpm for 7 days and transferring 1 mL into a fresh medium. Such procedure was repeated 8 times. Then, the total DNA was isolated and inspected on agarose electrophoresis as described previously. Furthermore, the isolated DNA was used as a template for PCR reaction with primers designed with Primer3Plus [88 (link)] specific for the DNA polymerase gene from autonomous D. hansenii VLEs: pCpolDNAF1 (5′ TTG GTG CGA TAT AGA TGG AAA A 3′) and pCpolDNAR1 (5′ TGC TTT TTA AAC CAG CTC CA 3′). The reaction mixture was: 0.4 µL DNA mixed with 10 µL of 2 × Taq Nova Red Master Mix (Blirt-DNA-Gdansk), 0.4 µL of 10 µM each primer, and 8.8 µL of distilled water. The PCR reaction was performed in a Personal Thermocycler (Biometra, Göttingen, Germany) under the following conditions: initial denaturation at 95 °C for 5 min; 35 cycles of denaturation at 94 °C for 1 min, primers annealing at 49 °C for 30s, extension at 72 °C for 1 min; and final elongation at 72 °C for 10 min. The product was visualized with ethidium bromide after electrophoresis in 1.2% agarose gel at 120 V for 40 min.
3
Molecular Identification of Organisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR ampli cation was performed on 12S rRNA and 16S rRNA genes and the ITS 2 spacer using primers (Table 1) and thermocycling conditions as previously described [4, 19] . Each reaction was prepared into a nal volume of 50 µl containing; 1´-reaction buffer (670 mM Tris-HC , pH 8.8, 166 μM (NH 4 ) 2 SO 4 , 4.5 % Triton X-100, 2 mg/ml gelatin) (Bioline, Humber Road, London, UK), 0.25 mM of each dNTP, 0.25 mM each of forward and reverse primers, 1.56 U BioTaq DNA polymerase (Bioline, London, UK), 1.25 mM MgCl 2 , 32.2 µl of PCR grade water and nally 5 µl of the template DNA.
The 16S ribosomal RNA gene was ampli ed in a thermocycler (Personal Thermocycler, Biometra, Göttingen, Germany) with initial denaturation of 94 °C for 5 min followed by 30 cycles at 94 °C for 30 s, 48 °C for 45 s, 72 °C for 45 s and a nal extension at 72 °C for 7 min. Ampli cation of the ITS2 and 12S ribosomal RNA was performed using similar thermocycling conditions to those of 16S at annealing temperature of 55 °C and 52 °C, respectively. PCR products were resolved on 2% agarose gels. The resultant PCR products were sized against a 1 kb DNA molecular ladder (Bioline, London, UK). The expected PCR product sizes ranged between 300-1200 bp. PCR products were puri ed using QIAquick PCR Puri cation Kit (Qiagen, Germantown, MD, USA) and commercially Sanger-sequenced (Inqaba Biotec, Muckleneuk, Pretoria, South Africa).
The 16S ribosomal RNA gene was ampli ed in a thermocycler (Personal Thermocycler, Biometra, Göttingen, Germany) with initial denaturation of 94 °C for 5 min followed by 30 cycles at 94 °C for 30 s, 48 °C for 45 s, 72 °C for 45 s and a nal extension at 72 °C for 7 min. Ampli cation of the ITS2 and 12S ribosomal RNA was performed using similar thermocycling conditions to those of 16S at annealing temperature of 55 °C and 52 °C, respectively. PCR products were resolved on 2% agarose gels. The resultant PCR products were sized against a 1 kb DNA molecular ladder (Bioline, London, UK). The expected PCR product sizes ranged between 300-1200 bp. PCR products were puri ed using QIAquick PCR Puri cation Kit (Qiagen, Germantown, MD, USA) and commercially Sanger-sequenced (Inqaba Biotec, Muckleneuk, Pretoria, South Africa).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!