Total RNAs of the renal tissues were extracted with the miRNA extraction kit (Sangon Biotech Co., Ltd., Shanghai, China). Reverse transcription was performed using a miRNA first-strand cDNA (synthesis tail method) kit (Sangon Biotech Co., Ltd., Shanghai, China). Specific primers for U6, miR-192, and miR-200b were designed by Qiagen (Valencia, CA, USA), and the primer sequences (5′→3′) were AACGCTTCACGAATTTGCGT, CTGACCTATGAATTGACAGCC, and TAATACTGCCTGGTAATGATGA, respectively. qPCR was carried out in 20 μL final volumes with 2 μL cDNA, 3 μL RNase-free H2O, 10 μL 2× miRNA qPCR Master Mix (Sangon, Shanghai, China), 2 μL universal PCR primer, 1 μL ROX Reference Dye (Sangon, Shanghai, China), and 2 μL specific primers. qPCR was performed with a real-time PCR thermocycler (Applied Biosystems, Foster City, CA, USA) under the following conditions: predenaturation at 95°C for 5 s and then 40 cycles of denaturation at 95°C for 30 s and annealing/extension at 60°C for 30 s. miR-192 and miR-200b relative expression levels were calculated using the 2−ΔΔCt method and normalized to the expression of U6.
Mirna qpcr master mix
Manufactured by Sangon
Sourced in China
2× miRNA qPCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) of microRNA (miRNA) targets. The master mix contains all the necessary components, including DNA polymerase, dNTPs, reaction buffer, and fluorescent dye, for efficient and sensitive miRNA quantification.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using mirna qpcr master mix
1
Quantifying Renal miRNA Expression
2
Quantitative Analysis of HCG18 and miR-197-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s instructions, a standard method was conducted to extract total RNA from serum via an extreme speed RNA extraction kit (HaiGene, Harbin, China). The concentration and purity of RNA samples were clarified by NanoDrop. The mixture of Probe One-Step RT-qPCR Kit (TAKARA, Tokyo, Japan) and total RNA was used to detect the levels of HCG18 on Roche LightCycler 480 (Roche, Basel, Switzerland). For miR-197-3p, the cDNA was amplified from total RNA using miRNA 1st strand cDNA synthesis kit (by stem-loop) (Vazyme, Nanjing, China). A 2×miRNA qPCR master mix (Sangon Biotech, Shanghai, China) was applied in the quantitative expression of miR-197-3p on Roche LightCycler 480 (Roche, Basel, Switzerland). After amplification, a melting curve was generated to evaluate the efficiency of primer pairs at the end of each PCR cycle. And the amplification of only one product in qRT-PCR was confirmed by a melting curve analysis. The relative expression levels of HCG18 and miR-197-3p were determined by normalizing them to the internal genes β-actin and U6 respectively.24 (link),25 (link) The relative expression of HCG18 and miR-197-3p was calculated using the 2-DeltaDeltaCt method. As for mRNA expression of IL18, the detection kits and protocols were the same as the detection of HCG18 expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!