Seqstudio

DNA was extracted from 20 mg of the fungal isolate tissues using the DNeasy extraction kit (Qiagen, Inc., Venlo, The Netherlands) according to the manufacturer’s protocol. For DNA fragments containing internal transcribed spacers, the fragments fungi primer is (Forward (ITS1): TCCGTAGGTGAACCTGC, Reverse (ITS4): TCCTCCGCTTATTGATATGC). Including 5.8S, were amplified and sequenced with primer pair ITS5/ITS4. The PCR profile was: 2.5 μL 10× buffer, 1.4 μL 50 mM MgCl₂, 1.6 μL 25 mM dNTPs, 0.5 μL of each 10 mM primer (forward and reverse), 1 μL 1 mg/mL BSA, 1 μL DNA, 0.3 μL 5 U/μL Taq polymerase, and 16.2 μL ddH₂O. The PCR conditions were 1 min at 95 °C, 35 cycles of 1 min at 95 °C, 45 s at 58 °C and 1 min at 72 °C, and finally, 10 min at 72 °C. The amplicons were sequenced for both strands using Big Dye Terminator in an ABI 3730 genetic analyzer (Applied Biosystems, Waltham, MA, USA). The sequences were edited, and primers were trimmed using Seq Studio (Life Technologies, Carlsbad, CA, USA) and run following a medium module. BLAST was used to compare the sequences against those existing in the National Center of Biotechnology Information (NCBI) nucleotide databases. Sequencing was performed using Seq Studio (Life Technologies, Carlsbad, CA, USA) and run following a medium module [12 (link),13 (link)].

We used the commercial kit PureLink Genomic DNA Mini Kit (Invitrogen, MA, USA) according to the manufacturer’s manual, obtaining a purified product of 40 uL. The sequencing primers can cover a region of about 1000 base pairs (bp) in the S gene. The sequencing reaction was performed using the BigDye Terminator V3.1 Cycle Sequencing kit. The BigDye reaction product was purified using 75% isopropanol, and at the end 10 uL of formamide was added to each well for sequencing using the SeqStudio (Applied Biosystems, Waltham, MA, USA).

For the purified colony of strain M7, morphological analysis was used for preliminary identification. M7 spore suspensions were cultured on MEA for 5 days at 28 °C; macroscopic morphology was observed, in terms of colony characteristics, aerial hyphae type, vegetative hyphae growth, spore formation and pigments excretion. Then, microscopic observation was performed on hyphae and conidiophore structure, followed by lactophenol cotton blue (LPCB) staining [9 (link)].
Molecular identification of strain M7 was completed by sequencing the internal transcribed spacer (ITS) region of the ribosomal DNA. Genomic DNA was isolated from fresh mycelium of culture grown on MEA. The fungal ITS region was amplified and sequenced with universal primer pairs ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC). The full-length ITS sequence was sequenced by Sanger sequencing (Applied Biosystems SeqStudio, ABI, Waltham, MA, USA), and analyzed via the Basic Local Alignment Search Tool (BLAST), and aligned using the ClustalW multiple alignment tool with homologous ITS sequences. The phylogenetic tree was then constructed using the neighbor-joining algorithm with 1000 bootstrap replicates in MEGA 7 [10 (link)].