Powerup sybr green master mix for qpcr

After infection, cells were collected by scraping and low-speed centrifugation and resuspended in TRI-Reagent (Merck Life Science S.r.l., Milano, Italy). The integrity of RNA was checked on 1% agarose gels and quantified at 260/280 ratio by using Eppendorf BioSpectometer basic (Eppendorf srl; Milano, Italy). RNA was converted to cDNA using High-Capacity cDNA Reverse Transcription Kit according to the production protocol (Applied Biosystems; Monza, Italy). Dilution of cDNA was performed to obtain a uniform amount of cDNA in all samples. Real-time PCR was performed by using CFX96 Touch Real-time PCR Detection System (Biorad; Italy): all samples (unknown, standard, and non-template control (NTC)) were run in triplicate according to the desired specifications of PowerUp SYBR Green Master Mix for qPCR (Applied Biosystems; Italy) used. Subsequently, Ct (cycle threshold) of the various samples was analyzed: relative quantification of target genes expression was performed by using 2^−ΔΔCT method in order to normalize the endogenous reference genes relative to the untreated control. Melting curves of all real-time PCR end products were analyzed to determine authentic products and contamination of non-specific products and primer dimer. GAPDH and 18s were used as internal controls. Target and endogenous genes are listed in Table 1 [90 (link)].

Three batches of samples from 20 carcasses of PIGB²⁷ and PIGB¹³ male larvae were dissected, collected, and frozen at −80°C (biological replicates = 3). Total RNA was extracted using a PureLink RNA Mini Kit (12183018A; Thermo Fisher Scientific). SuperScript III Reverse Transcriptase (18080044; Thermo Fisher Scientific) and oligo(dT) primers were used for reverse transcription. Real-time PCR was performed on a QuantStudio 12K Flex system (Applied Biosystems) with PowerUp SYBR Green Master Mix for qPCR (A25742; Thermo Fisher Scientific). Experiments were performed with triplicates of each sample. The amount of amplified transcript was normalized against that of an internal control (rpl32). The primers used in this study are listed in Table S3.

Real-time qPCR was conducted using PowerUp SYBR Green Master Mix for qPCR (Thermo Fisher Scientific, A25741) following the manufacturer’s instructions. The following oligomers were produced by Genscript and were used as primers. GAPDH (GGACTTACAGAGGTCCGCTT and CTATAGGGCCTGGGTCAGTG), TNF (CTCATGCACCACCATCAAGG and ACCTGACCACTCTCCCTTTG), IL-6 (CTCTGGCGGAGCTATTGAGA and AAGTCTCCTGCGTGGAGAAA), IL-12b (GCACCAGCTTCTTCATCAGG and GGCAGACATCGTCTTTGCTT). QuantStudio 12 K Flex Real-Time PCR System (Thermo Fisher Scientific) was used to conduct real-time qPCR. The relative quantity of TNF, IL-6, and IL-12b was normalized to the relative quantity of GAPDH. Finally, the expression level of the cytokines was normalized to the control sample and the fold change was calculated.