The nCounter gene expression assays (NanoString Technologies, Seattle, WA) were performed using a custom-made combination of Neuropathology and Neuroinflammation NanoString panels. Briefly, panel code-set probes were hybridized with 150 ng of total RNA per specimen over 18hr at 65 °C in a SimplyAmp Thermocycler (Applied Biosystems, Waltham, MA), according to manufacturer’s protocol. Hybridized RNA was then diluted in molecular grade water and loaded into nCounter SPRINT cartridge (NanoString) in nCounter SPRINT Profiler, and then RNA-conjugated probes were counted via NanoString Sprint Profiler technology. Results from each panel were merged into one data file for comparative analysis. Reference gene normalization was performed for each sample by dividing each sample’s raw count profiles by the geometric mean of 8 reference genes in nSolver, as previously described (Danaher et al., 2017 (link)). Genes that did not show signal in any specimen were excluded from subsequent systems analysis.
Simplyamp thermocycler
Manufactured by Thermo Fisher Scientific
The SimplyAmp Thermocycler is a compact, easy-to-use thermal cycler designed for PCR amplification. It features a simple user interface and can perform a wide range of PCR protocols.
Automatically generated - may contain errors
Lab products found in correlation
Ncounter sprint cartridge, by NanoString (1 mentions)
Ncounter gene expression assay, by NanoString (1 mentions)
Amplitaq gold, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator 3, by Thermo Fisher Scientific (1 mentions)
3730xl sequence analyzer, by Thermo Fisher Scientific (1 mentions)
Geneamp pcr system 9700, by Thermo Fisher Scientific (1 mentions)
Sequencher 5, by Gene Codes (1 mentions)
2 protocols using simplyamp thermocycler
1
NanoString Neuropathology and Neuroinflammation Gene Expression Analysis
2
Genotyping chr13 variants in Shelties
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers were designed to amplify the region around the two variants of interest on chr13, chr13:43897196 (F- GCTCCCAAGAAGGGACAGAC; R- TTGGAATAAGATGACAGAGCAAG) and chr13:44170972 (F- AAACGATCCAGAGAGCAGATTAC; R- GAGCCCAGGCCAAGAGTG) using Primer3106 (link). PCR was carried out on a SimplyAmp thermocycler or GeneAmp PCR system 9700 (Applied Biosystems, Foster City, CA) using AmpliTaq Gold (Thermo Fisher, Waltham, MA) using standard reaction protocols with a touch-down thermocycler program starting at 65 oC annealing temperature and decreasing 0.5 oC each cycle for 20 cycles then an additional 20 cycles at 55 oC annealing temperature. Denaturing and extending temperatures were constant as per standard protocols.
Amplified DNA was sequenced using BigDye Terminator 3.1 (Applied Biosystems, Foster City, CA) and run on a 3730xl sequence analyzer (Applied Biosystems). The variants were genotyped using Sequencher 5.4.6 (GeneCodes Corporation, Ann Arbor, MI). Odds ratios were calculated using genotypes from 47 affected and 47 unaffected Shelties.
Amplified DNA was sequenced using BigDye Terminator 3.1 (Applied Biosystems, Foster City, CA) and run on a 3730xl sequence analyzer (Applied Biosystems). The variants were genotyped using Sequencher 5.4.6 (GeneCodes Corporation, Ann Arbor, MI). Odds ratios were calculated using genotypes from 47 affected and 47 unaffected Shelties.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!