Genejet plasmid miniprep kit

The psiCHECK-2-vector, obtained from Promega GmbH (Madison, WI, USA), was digested with EcoRI (Fermentas, Thermo Scientific, Waltham, MA, USA), and converted to a Gateway® destination vector using a Gateway® Vector Conversion System (Invitrogen, Life Technologies, Paisley, UK) by ligating the reading frame cassette according to the manufacturer’s instructions. The resulting destination vector was sequenced to confirm correct orientation of the reading frame cassette. The human bcl-2 ORF shuttle expression clone with a Gateway® entry vector was obtained from ImaGenes (Source BioScience, Berlin, Germany). The psiCHECK2-bcl-2 plasmid was generated by an LR recombination reaction and transformed into Escherichiacoli XL1-Blue. The vector was sequenced to confirm successful cloning, and isolated from E. coli XL1-Blue using a GeneJET™ Plasmid Miniprep Kit (Fermentas, Thermo Scientific).
200 μl of an E. coli XL-1 Blue stock were transformed by heat-shock with 100 ng psiCHECK-2-bcl-2 plasmid and plated onto an ampicillin agar-plate. Miniprep cultures were grown from a single colony. The plasmid was isolated with the GeneJET Plasmid Miniprep Kit (Fermentas, Thermo Scientific) according to the manufacturer’s instructions.

Cloning in E. coli was performed essentially as described in Sambrook and Russel (2001 ). Genomic DNA from B. licheniformis was isolated as previously described (Nahrstedt et al. 2004 (link)) or by using a commercially available kit (GeneJET Plasmid Miniprep Kit, Thermo Fisher Scientific Inc., Waltham, USA; QuickExtract™ DNA Extraction Solution, Epicentre^®, Madison, USA). Plasmid DNA was purified with the GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific Inc., Waltham, USA). For in vitro amplification of DNA, PCR samples (100 µl) contained 200 µM dNTPs, 100 ng template DNA, 1 pmol of each primer and 1 U Taq, Q5 (New England Biolabs GmbH, Frankfurt a.M., Germany) or the Phusion DNA polymerase (Finnzymes Thermo Fisher Scientific Inc., Waltham, USA). Purification of amplified or restriction fragments from gels was performed applying a GeneJET Gel Extraction Kit (Thermo Fisher Scientific Inc., Waltham, USA). Nucleotide sequences were determined by Eurofins Genomics with the didesoxy chain-termination method (Sanger et al. 1977 (link)) using the Mix2Seq kit (Eurofins Genomics GmbH, Ebersberg, Germany).

mTERC and alTERC genes were amplified by PCR using the following primers : TERC Fw: AGGCCTCGGCACCTAACCCTGA; TERC Rv: CAGCGGGAATGGGGGTTGTG;
alTERC Fw: TGTGGCCTGTGTCTAACCCTGC; alTERC Rv: GGTGCACTTCCCGCAGCTCA.
The mTERC 420 bp and alTERC 377 bp products were separately inserted into a pGM plasmid and transfected to E.coli grown in the presence of ampicillin [0.1mg/ml]. The plasmids were extracted from E.coli using Gene JET Plasmid Miniprep kit (Thermo scientific, USA) following by PCR amplification, agarose gel analysis, extraction of the DNA products from the gel and verification by sequencing. Retroviral expressing vectors containing the TERC and alTERC genes were prepared by cloning of these genes into custom made retroviral plasmid NV-5119 (described above) and transfected into XL-10 Gold ultra-competent bacteria (Agilent/Stratagene). The plasmids were purified from the different bacterial colonies using the GeneJET Plasmid Miniprep Kit (Thermo) and the extracted DNA was analysed for the presence of TERC and alTERC by using restriction enzyme, EcoRI, according to the digesting map, and the correct constructs were verified by DNA sequencing. The constructs were sub-cloned into bacteria DH-5α to increase the yield of the plasmid.