Calcium phosphate transfection kit

HEK293T cells were cultured to ~60% confluency before transient transfection with pcDNA3.1-p300-FLAG. The cell growth medium was changed at least 1 hr before transfection. Cells were transfected with the Calcium Phosphate Transfection Kit (Thermo Fisher Scientific, Waltham, MA) using 15 µg DNA per T75 flask for FLAG-p300. Lipofectamine 3000 (Invitrogen) was used to transfect cells with a plasmid containing the HA-Su3(ΔGG)-H4 gene, and the media was changed 24 hr after transfection. Cells were grown in transfection medium over 48 hr before detachment by trypsin and collection by centrifugation. The cell pellet was washed thrice with ice-cold Dulbecco’s phosphate-buffered saline before either protein purification or storage at –80°C.

Nestin-Tv-a;Ink4a/Arf^−/− mice (BL/6 background) and Nestin-Tv-a mice (BL/6 background) have been previously described and were bred within the Netherlands Cancer Institute (NKI) animal facility. The RCAS-PDGFB-driven mouse models of gliomagenesis (PDG) have been previously described^{16 ,26 (link),27 (link),70 (link)–72 (link)}. Briefly, glioblastomas were induced in 5–6-week-old male and female mice by intracranial injection of DF-1 cells expressing an RCAS vector encoding PDGF-B HA in Nestin-Tv-a;Ink4a/Arf^−/− mice (PDG-Ink4a model), or DF-1 cells expressing PDGF-B HA and a short hairpin RNA targeting TP53 in Nestin-Tv-a mice (PDG-p53).
The PDG-Ink4a-OVA model was developed by cloning the OVA sequence into the RCASBP-Y vector. DF1 cells were transfected using the calcium phosphate transfection kit (ThermoFisher) to generate DF1-OVA cells. Successful transfection was confirmed by flow cytometry assessment of OVA expression (Extended Data Fig. 2a). To induce tumor development, Nestin-Tv-a;Ink4a/Arf^-/- mice were intracranially injected with a 1:1 ratio of 200,000 DF1-PDGFB and 200,000 DF1-OVA cells. For the GL261 model, 20,000 GL261 cells were intracranially injected in C57BL/6JRj mice (Janvier labs) to induce tumor development. All animal studies were approved by the Institutional Animal Care and Use Committees of the NKI.

All cell lines were purchased from the American Type Culture Collection (ATCC) and maintained at 37 °C with 5% CO2. A375 (ATCC^®CRL-1619), G-361 G361 (ATCC^®CRL-1424), MeWo (ATCC^®HTB-65), SK-MEL-2 (ATCC^®HTB-68), SK-MEL-3 (ATCC^®HTB-69), SK-MEL-24 (ATCC^®HTB-71), WM2032 (ATCC^®HTB-70), and HEK293T (ATCC^®CRL-3216) cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (FBS; Invitrogen), 2 mM l-glutamine, and 1% penicillin–streptomycin (Gibco-BRL). Transfections were performed according to the manufacturer’s instructions with lipofectamine 2000 (Invitrogen) or calcium phosphate transfection kit (Thermo). None of the cell lines used in this study was found in the database of commonly misidentified cell lines that is maintained by ICLAC and NCBI Biosample. All cell lines were tested and confirmed to be free of mycoplasma.

Human KRT17 cDNA was obtained by RT-PCR using RNA taken from the gingiva of a volunteer. The primer sequences were CCCACTTGGTGGCCTATAAA and GTCATCAGGCAAGGAAGCAT. The KRT17 cDNA was cloned into pcDNA3 (Thermo Fisher Scientific). KRT13 cDNA was obtained as previously described [11 (link)]. The cells were transfected with the plasmid using FuGene6 (Roche Diagnostics), and G418 (500 μg/ml)-resistant clones were isolated. Knockdown plasmid was generated using the BLOCK-iT Pol II miR RNAi Expression Vector Kits (Thermo Fisher Scientific). Transfection was carried out using the Calcium Phosphate Transfection Kit (Thermo Fisher Scientific) and the cells were selected in blasticidin (5 μg/ml).

βII-spectrin-ΔCH-GFP and βII-spectrin-ΔPH-GFP plasmids were modified from FUGW-GFP plasmid (Addgene, 14883). In details, for βII-spectrin-ΔCH-GFP construct, 1–303 amino acids truncated βII-spectrin was amplified from wide-type βII-spectrin and inserted into FUGW-GFP. A GGGGS peptide linker was inserted between truncated βII-spectrin and GFP. Likewise, for βII-spectrin-ΔPH-GFP, 2169–2364 amino acids truncated βII spectrin was amplified from wide-type βII-spectrin and inserted into FUGW-GFP with a GGGGS peptide linker. Plasmids were transfected into cultured neurons at DIV 7–9 using a calcium phosphate transfection kit (Thermo Fisher, K2780-01). Experiments were performed 2 or 3 days post transfection.